A kind of varroa mite toxic protein and its coding gene and application
A virulent protein, Varroa destructor technology, applied in the field of biochemistry and molecular biology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0014] 1. Cloning of toxin protein gene
[0015] Get about 60 Varroa mites, use TriZolReagent (Invitrogen Company, its article number: 15596026) to extract total RNA, use agarose gel electrophoresis and ultraviolet spectrophotometer to detect the purity and amount of total RNA, and take 1 μg of total RNA to make Initiate the reverse transcription reaction, the reverse transcription kit used is SMARTer TM RACE cDNA Amplification Kit (Clontech, catalog number: 634923), the reverse transcription reaction steps refer to the instructions of the kit to obtain the reverse transcription product.
[0016] Using the reverse transcription product as a template, design specific primers for the VMP gene:
[0017] VMPF1 (5'ATGTTCAAACTTCTCGTTATCG3')
[0018] VMPR1 (5'TTAGGAGGCGAGCGCCTGCTGGA3')
[0019] Use high-fidelity Taq enzyme for PCR. The PCR reaction system is: reverse transcription product 1 μL, 10xBuffer 5 μL, dNTP (each 2.5 mM) 4 μL, VMPF1 (10 μM) 1 μL, VMPR1 (10 μM) 1 μL, Taq e...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com