Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker for identifying genotype of rice chalkiness major effect gene and application of molecular marker

A technology of molecular markers and major genes, applied in the field of plant biology, can solve the problems of difficulty in meeting breeding needs and high costs, and achieve the effect of meeting large-scale molecular breeding, moderate marker amplification fragments, and improving breeding efficiency

Inactive Publication Date: 2015-07-22
SOUTH CHINA AGRI UNIV
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Traditional SNP locus identification is usually based on sequencing, enzyme digestion or gene chip analysis, which is costly when identifying a large number of samples and is difficult to meet breeding needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for identifying genotype of rice chalkiness major effect gene and application of molecular marker
  • Molecular marker for identifying genotype of rice chalkiness major effect gene and application of molecular marker
  • Molecular marker for identifying genotype of rice chalkiness major effect gene and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Primer design and amplified fragment analysis of the functional marker Chalk5-T / C of rice chalky gene

[0035] 1. Primer design

[0036] Aiming at the promoter SNP site "-576-T / C" of the chalky gene Chalk5 (T-high chalky varieties, C-low chalky varieties), use the online tetra-primer ARMS-PCR primer design tool Primer1 (http: / / primer1.soton.ac.uk / primer1.html) Design a functional marker Chalk5-T / C that covers the different sites, and at the same time introduce a mismatch base at the 3'end of the allele-specific primer, Increase specificity ( figure 1 ). The Chalk5-T / C is composed of 4 primers Chalk5-O-F, Chalk5-O-R, Chalk5-C-F and Chalk5-T-R. The primer sequences (5’-3’) are as follows:

[0037] Chalk5-O-F: TCAAAAACCACCATTCGAAATGA

[0038] Chalk5-O-R: TGTGTATAAACATTTTTGTTGTTTTTGCA

[0039] Chalk5-C-F: CATTTTCAGTGCGTCCAAA A CC

[0040] Chalk5-T-R: AAGTTATATACGGTGCGTCTCAT G GA

[0041] (The underlined bases in the primer sequence are the introduced ...

Embodiment 2

[0044] Example 2 Using the functional marker Chalk5-T / C to analyze the chalky genotypes of 5 rice varieties

[0045] 1. Extraction of rice genomic DNA

[0046] Five rice varieties are used as materials: Minghui 63, Basmati 370, Zhenshan 97B, IR64, Zhenshan 97B / Minghui 63. Select the tender leaves of a single rice plant, and extract rice genomic DNA using the CTAB method. The specific steps are as follows: (1) Take an appropriate amount of fresh leaves and place them in a 2 mL centrifuge tube, add liquid nitrogen to mash, and add 1 mL of CTAB extract to the centrifuge tube. , Shake well; (2) Place in a 65℃ water bath or thermostat, shake gently every 10 minutes, take out after 30~45 minutes; (3) After cooling for 2 minutes, add chloroform-isoamyl alcohol (24:1) (4) Put the centrifuge tube in a centrifuge at 15,000 r / min and centrifuge for 10 minutes and then take it out; (5) Carefully transfer the supernatant to a new sterile centrifuge tube Then add 600μL of pre-cooled i...

Embodiment 3

[0065] Example 3 Using Rice Chalkiness Gene Molecular Marker Chalk5-T / C to Identify Low Chalkiness Genotype Rice Single Plant

[0066] 1. Experimental materials: 10 individual rice plants of the F2 offspring of the hybrid rice variety Huazhan and the polymerization line "H463".

[0067] 2. Extraction of Rice Genomic DNA: Same as Example 2.

[0068] 3. Functional marker Chalk5-T / C amplification: the same as in Example 2.

[0069] 4. Capillary electrophoresis detection and genotype determination of amplified products

[0070] Dilute the amplified product and transfer it to Fragment Analyzer® Automated CE System (AATI, USA) for detection, follow the operating instructions of the kit DNF-910-K2000, and use PROSize® 2.0 data analysis software for data analysis, and finally Genotype is judged:

[0071] The amplified products are two fragments of 298 bp and 196 bp, showing that the genotype of the marker individual is C / C homozygous ( image 3 The first, third, and si...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant biology and particularly discloses a molecular marker for identifying a genotype of a rice chalkiness major effect gene and application of the molecular marker. The molecular marker consists of a pair of outer primers Chalk5-O-F and Chalk5-O-R and a pair of inner primers Chalk5-C-F and Chalk5-T-R, and a primer sequence is shown in SEQ IDNO:1-4. The marker is moderate in amplified fragments and strong in specificity; when the marker is utilized for identifying the genotype of the rice chalkiness major effect gene Chalk5, gene typing can be performed on the rice chalkiness major effect gene only through simple PCR without sequencing; rice varieties with high and low chalkiness are distinguished, so that molecular marker-assisted selection performed on rice chalkiness characters is realized. The molecular marker disclosed by the invention can be used for the molecular marker-assisted selection of a rice improvement and separation population, improves the breeding efficiency and meets the large-scale molecular breeding requirements.

Description

technical field [0001] The invention relates to the field of plant biotechnology, more specifically, to a molecular marker for identifying the genotype of rice chalkiness main gene and its application. Background technique [0002] Rice is an important crop in my country, and the quality of rice is directly related to the economic benefits of rice production and the quality of life of the people. Chalkiness is the opaque part of rice endosperm, and it is one of the most important indicators of rice appearance quality in my country. Rice with a low chalky grain rate and no chalkiness has excellent appearance characteristics; in addition, rice with a low chalky rate generally has a correspondingly higher polished rice rate, less broken rice after milling, and high commodity value. Therefore, rice varieties with low chalkiness are very popular among rice processing enterprises and consumers. Rice chalkiness traits are controlled by both genetic and environmental factors, and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68
Inventor 郭涛陈立凯黄翠红周丹华罗文龙陈志强王慧
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com