Novel TALEN carrier suitable for sorangium cellulosum and construction method of novel TALEN carrier
A technology of S. cellulosus and carrier, which is applied in the fields of biochemistry and molecular biology. It can solve the problems of slow progress in the genetic engineering of S. cellulosus and achieve the effect of promoting development and broadening the scope of application.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0014] Embodiment 1: Construction of pET22b-ADH2 recombinant plasmid:
[0015] 1. Acquisition of ADH2 gene.
[0016] 1. Design primers:
[0017] Upstream primer: GGAATTCCATATGTCTATTCCAGAAACTCAAAAAAG
[0018] Downstream primer: GCCCTCGAGTTTAGAAGAGTCAACAACGT
[0019] 2. extract the genome of Saccharomyces cerevisiae As2.4 with kit, obtain the ADH2 gene of the band restriction site of length about 1024bp by PCR amplification as above and verify by sequencing (its nucleotide sequence is as SEQ ID NO.1 and Shown in SEQ ID NO.2, the Genbank accession number of the base sequence of the ADH2 gene is NM_001182812.1),
[0020] The PCR reaction system is as follows:
[0021]
[0022] The PCR amplification procedure is as follows:
[0023]
[0024]
[0025] The recovered PCR product was treated with NdeI and XohI at 37°C for 2h. The pET22b vector was treated with NdeI and XohI at 37°C for 2 hours, and the digested product was recovered. Ligate the two digested products at ...
Embodiment 2
[0026] Embodiment 2: Construction of TALEN target vector
[0027] The 17bp sequence in the ADH2 gene obtained by sequencing was used as the knockout target, and the Ptalen L48 and Ptalen R36 (Shanghai Stance Biological Technology Co., Ltd., catalog number: 1901 / 1902 / 1903-010) vectors were used to target the upstream and downstream of the knockout target 17bp sequence (such as figure 2 Shown in A), when the repeating unit was constructed using the FastTALE TALEN kit (Shanghai Stance Biological Technology Co., Ltd., Cat. No.: 1901 / 1902 / 1903-010), it was connected to the Ptalen L48 and Ptalen R36 vectors, and double-digested And the sequencing results showed that the knockout vector was constructed successfully ( figure 2 B). Using the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4 as primers, using the pBEP43 vector as a template, amplify the P43 promoter sequence, and digest the Ptalen L48 vector with restriction endonucleases HindIII and SpeI With the P43 promo...
Embodiment 3
[0029] Co-transformation of P43LTALEN, P43RTALEN and pET22b-ADH2
[0030] Take 3 μL of each of P43LTALEN, P43RTALEN and pET22b-ADH2, adjust the concentration to 150ng / μl, and add it to the competent cell of S. cellulosus Soce M4, and add another 3 μL of 150ng / μl pET22b-ADH2 to the competent cell fiber Put the bacteria in So ce M4, put it on ice for 2 minutes, immediately add it to the ice pre-cooled electric transfer cup, 1500V, 5.0ms for electrotransformation, immediately add it to 6mLG52 liquid medium, 30°C, 150rpm to recover for 3h , the bacterial solution added with three kinds of plasmids and a single plasmid was respectively applied to the G52 plate containing 100 μg / ml Amp, 50 μg / ml Kan and the G52 plate containing only 100 μg / ml Amp, and cultivated at 37 ° C. Single clones were picked for expansion and cultured, and the bacterial solution was identified by PCR. The primers used were shown in SEQ ID NO.1 and SEQ ID NO.2. Such as Figure 4 As shown, the PCR fragment (L...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap