Recombinant Adenovirus Expressing Porcine α-Interferon and Porcine γ-Interferon Simultaneously
A technology of recombinant adenovirus and alpha interferon, applied in the field of recombinant adenovirus, can solve the problems of low antiviral effect, low inhibition efficiency, etc., and achieve the effects of economy, use, ease of use, and high efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] [Example 1] Production of recombinant adenovirus
[0024] The porcine alpha interferon and porcine alpha interferon sequences were inserted behind the CMV promoter, and the foot-and-mouth disease virus 2A gene was inserted between the two genes to allow their simultaneous expression, which has been described in figure 1 shown in .
[0025] A more specific description is as follows: pig interferon alpha 1 is used to extract the genetic information of the gene bank no.NM_214393, and the pig interferon gamma gene is used to extract the genetic information of the gene bank no.AY293733, and the SEQ ID NO: The foot-and-mouth disease virus 2A sequence (CAGCTGTTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGCCCAACCCTGGGCCC:SEQ ID NO:1) shown in 1 is configured between two porcine interferon genes, thereby the gene shown in SEQ ID NO:2 is carried out by (strain) Baiye (Bioneer) synthesis. At this time, an NheI restriction enzyme site was inserted into the 5' end of the synthetic gene se...
Embodiment 2
[0046] [Example 2] Confirmation of the expression of pig interferon alpha or interferon gamma
[0047] Western blotting was used to confirm the expression of porcine interferon-alpha and interferon-gamma in the recombinant adenovirus. The day before Western blotting, prepare IBRS-2 (porcine kidney cells) and place them in a 75cm 2 In the flask, after the formation of 90% cell monolayer the next day, dilute about 1×10 8 The tissue culture infectious dose (TCID) of adenovirus was inoculated into new medium respectively. 48 hours after inoculation, the culture medium was recovered and concentrated by an Amic on ultracentrifugal filter (Millipore) and applied to Western blotting. In order to compare the protein expression, the adenovirus expressing porcine alpha interferon (Ad-porcine IFN-α), the adenovirus expressing porcine gamma interferon (Ad-porcine IFN-γ), and the simultaneous expression of porcine alpha interferon and gamma Adenovirus with interferon (Ad-porcine IFN-αγ) ...
Embodiment 3
[0048] [Example 3] Quantification of porcine alpha interferon or gamma interferon and confirmation of protein by enzyme-linked immunosorbent assay (ELISA)
[0049] Expressed in the recombinant adenovirus prepared above by using porcine α-interferon ELISA kit (Enzyme-linked immunosorbentassay) (Uscn Life Science Co., Ltd.) and porcine γ-interferon ELISA kit (Thermosicentific) Quantification of porcine interferon-alpha and interferon-gamma. The results are shown in Table 1.
[0050] Table 1
[0051]
[0052] As shown in Table 1 above, it was confirmed that the 1×10 4 The titer of Ad-pig IFNαγ expressed the same level of protein as that expressed in Ad-pig IFN-α or Ad-pig IFN-γ, and confirmed that, in Ad-pig IFNαγ, as expected Likewise, both alpha interferon and gamma interferon are expressed.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com