PCR detection method for detecting four kinds of poultry respiratory disease pathogens simultaneously
A detection method, respiratory technology, applied in the field of PCR detection of four kinds of poultry respiratory disease pathogens at the same time, can solve the problems of increasing experimental links and increasing experimental pollution, and achieve the effect of improving detection efficiency, simplifying operation steps, and improving accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] (1) Extraction and purification of tissue total RNA: use the trizol method or a kit to extract the nucleic acid of the sample to be tested, and use it as the template used in the PCR reaction system;
[0042] (2) Design primers: According to the mRNA sequences in poultry tissues registered on Genbank, use Primer 5.0 to design primers for PCR detection of poultry gene expression, that is, design 4 pairs for the conserved regions of AIVH5, AIVH9, NDV and IBV genomes Primers:
[0043] AIVH5 upstream primer: 5ˊACAAAGCTCTCTATCAAAACCCAAC3ˊ
[0044] Downstream primer: 3ˊTACCATCTACCAACCATACCCAT5ˊ
[0045] AIVH9 upstream primer: 5ˊATCGGCTGTTAATGGAATGTGTT3ˊ
[0046] Downstream primer: 3ˊAATGGGATAAGTTCTGCGGGT5ˊ
[0047] NDV upstream primer: 5ˊGAGGTTACCTCYACYAAGCTRGAGA3ˊ
[0048] Downstream primer: 3ˊTCATTAACAAAYTGCTGCATCTTCCCWAC5ˊ
[0049] IBV upstream primer: 5ˊACTGAACAAAAGACAGACTTAGT3ˊ
[0050] Downstream primer: 3'CACTCTGAGCTGTTTGTGTTTG5'
[0051] On the prem...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com