A set of universal detection primers and kits for microsporidia molecules
A microsporidian, general detection technology, applied in the direction of microbial determination/inspection, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of unsatisfactory sensitivity, less primer sensitivity, low sensitivity, etc., to achieve a wide range of applications , good detection sensitivity, the effect of increasing the range
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Bombyx mori Microsporidia HMG1 gene
[0044] 1. According to the method of gene homologous cloning in the gene cloning technology of molecular biology, the cDNA and DNA full-length sequence of the HMG1 gene of No. silkworm were cloned.
[0045] 2. Obtaining the full length of cDNA, the specific method is as follows:
[0046] (1) The primers HMG1F / HMG1R were designed by using Primerpremier5.0 software combined with comprehensive analysis, the sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.
[0047] Upstream primer HMG1F (SEQ ID NO.3):
[0048] 5'ATGACTGCTCAAAAAGACGATAC3'
[0049] Downstream primer HMG1R (SEQ ID NO.4):
[0050] 5'TTATTCATCACTATCTCCTACTTCT3'.
[0051] (2) Using the purified spore DNA of N.b. mori as a template, PCR amplification was performed with primers HMG1F / HMG1R.
[0052] (3) The PCR product was purified, ligated into pMD19T, and transformed into E.coliDH-5α for culture.
[0053] (4) The recombinant plasmid wa...
Embodiment 2
[0057] Embodiment 2 detection primer design and establishment of PCR amplification method
[0058] 1. Primer design
[0059] On the basis of obtaining the HMG1 gene of Bombyx mori, Primerpremier5.0 software was used to design and design multiple pairs of primers. After a large number of drug resistance, specificity and sensitivity tests, three pairs of primers were finally selected as a representative primer set. , the sequences of each set of primers are as follows:
[0060] (1) The first pair:
[0061] Upstream primer HMG1F (SEQ ID NO.3):
[0062] 5'ATGACTGCTCAAAAAGACGATAC3'
[0063] Downstream primer HMG1R (SEQ ID NO.4):
[0064] 5'TTATTCATCACTATCTCCTACTTCT3'.
[0065] (2) The second pair:
[0066] Upstream primer HMG1-sF (SEQ ID NO.5):
[0067] TTCCGAAATAATCTTCTTTTAATTG
[0068] Downstream primer HMG1-sR (SEQ ID NO.6):
[0069] TTGTGCACCGAATCGTAAATAG
[0070] (3) The third pair:
[0071] Upstream primer HMG1-xF (SEQ ID NO.7):
[0072] TCCCTAGGAACTTTTAAAGAGAAG ...
Embodiment 3
[0096] Example 3 Primer Specific Detection
[0097] 1. Using the DNA of No. silkworm (N.b), No. tussah mori (N.a) and No. corn borer (N.f) as templates, primers HMG1F / HMG1R, HMG1-sF / HMG1-sR, HMG1-xF / HMG1-xR, PCR amplification was carried out by the method of Example 2, and the results were detected by agarose gel electrophoresis after the amplification was completed.
[0098] 2. The amplification results of the three pairs of primers are shown in the attached Figure 4~6 shown. The results showed that both the primers HMG1F / HMG1R and the primers HMG1-xF / HMG1-xR could detect a variety of microsporidia, and had good universal detection ability. However, the primers HMG1-sF / HMG1-sR can only specifically detect No. spp.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com