Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A set of universal detection primers and kits for microsporidia molecules

A microsporidian, general detection technology, applied in the direction of microbial determination/inspection, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of unsatisfactory sensitivity, less primer sensitivity, low sensitivity, etc., to achieve a wide range of applications , good detection sensitivity, the effect of increasing the range

Active Publication Date: 2016-06-29
SOUTH CHINA AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the target genes of the primers designed in the research of silkworm microsporidian PCR detection technology are also SSUrRNA, and the primers designed for other microsporidian genes are less or have poor sensitivity, so they are rarely reported
Bakeretal (1995) and Terry etal (1999) designed PCR primer V1f / 530r based on the highly conserved region of SSUrRNA of similar species of Microsporidia, which can identify DNA templates of various species of Microsporidia and amplify a specific target band of about 450bp. However, the sensitivity is far from satisfactory, and the inventors have found that when using the primers to detect No. (N.b) PCR amplification of DNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A set of universal detection primers and kits for microsporidia molecules
  • A set of universal detection primers and kits for microsporidia molecules
  • A set of universal detection primers and kits for microsporidia molecules

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Bombyx mori Microsporidia HMG1 gene

[0044] 1. According to the method of gene homologous cloning in the gene cloning technology of molecular biology, the cDNA and DNA full-length sequence of the HMG1 gene of No. silkworm were cloned.

[0045] 2. Obtaining the full length of cDNA, the specific method is as follows:

[0046] (1) The primers HMG1F / HMG1R were designed by using Primerpremier5.0 software combined with comprehensive analysis, the sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0047] Upstream primer HMG1F (SEQ ID NO.3):

[0048] 5'ATGACTGCTCAAAAAGACGATAC3'

[0049] Downstream primer HMG1R (SEQ ID NO.4):

[0050] 5'TTATTCATCACTATCTCCTACTTCT3'.

[0051] (2) Using the purified spore DNA of N.b. mori as a template, PCR amplification was performed with primers HMG1F / HMG1R.

[0052] (3) The PCR product was purified, ligated into pMD19T, and transformed into E.coliDH-5α for culture.

[0053] (4) The recombinant plasmid wa...

Embodiment 2

[0057] Embodiment 2 detection primer design and establishment of PCR amplification method

[0058] 1. Primer design

[0059] On the basis of obtaining the HMG1 gene of Bombyx mori, Primerpremier5.0 software was used to design and design multiple pairs of primers. After a large number of drug resistance, specificity and sensitivity tests, three pairs of primers were finally selected as a representative primer set. , the sequences of each set of primers are as follows:

[0060] (1) The first pair:

[0061] Upstream primer HMG1F (SEQ ID NO.3):

[0062] 5'ATGACTGCTCAAAAAGACGATAC3'

[0063] Downstream primer HMG1R (SEQ ID NO.4):

[0064] 5'TTATTCATCACTATCTCCTACTTCT3'.

[0065] (2) The second pair:

[0066] Upstream primer HMG1-sF (SEQ ID NO.5):

[0067] TTCCGAAATAATCTTCTTTTAATTG

[0068] Downstream primer HMG1-sR (SEQ ID NO.6):

[0069] TTGTGCACCGAATCGTAAATAG

[0070] (3) The third pair:

[0071] Upstream primer HMG1-xF (SEQ ID NO.7):

[0072] TCCCTAGGAACTTTTAAAGAGAAG ...

Embodiment 3

[0096] Example 3 Primer Specific Detection

[0097] 1. Using the DNA of No. silkworm (N.b), No. tussah mori (N.a) and No. corn borer (N.f) as templates, primers HMG1F / HMG1R, HMG1-sF / HMG1-sR, HMG1-xF / HMG1-xR, PCR amplification was carried out by the method of Example 2, and the results were detected by agarose gel electrophoresis after the amplification was completed.

[0098] 2. The amplification results of the three pairs of primers are shown in the attached Figure 4~6 shown. The results showed that both the primers HMG1F / HMG1R and the primers HMG1-xF / HMG1-xR could detect a variety of microsporidia, and had good universal detection ability. However, the primers HMG1-sF / HMG1-sR can only specifically detect No. spp.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a group of microsporidium molecule universal detection primers and a kit thereof. The universal detection primers include an upstream primer HMG1F and a downstream primer HMG1R; the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.4. The detection primers target at the gene HMG1 and can be applied to detecting a plurality of microsporidia simultaneously, and the detection results are reliable, easy to operate and high in sensitivity; especially, the universal detection primers have extremely important practical application significance to early detection of various microsporidia in a sample in practical quarantine work.

Description

technical field [0001] The invention belongs to the technical field of insect pathogenic microorganism molecular detection. More specifically, it relates to a set of universal detection primers for microsporidia molecules and a kit thereof. Background technique [0002] The study of silkworm microsporidia began in 1845 with the nationwide epidemic of microsporidia in France. Pasteur determined that the "particles" he observed were the causative factors of microsporidia. sporozoite pathogen. In particular, Nosporum silkworm has two transmission routes, horizontal transmission and vertical transmission, among which vertical transmission causes great harm to the production of silkworm eggs in sericulture production, and at the same time has a great negative impact on the yield and quality of silkworm cocoons in silk cocoon breeding , seriously affecting the development of the downstream economy of the silk industry chain (Cai Shunfeng et al., 2011). Since the outbreak of mic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/6893Y02A50/30
Inventor 刘吉平宋小景程伟
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com