Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Caragana korshinskii Kom. transcription factor CkMYB4 and its gene

A Caragana caragana, transcription factor technology, applied in genetic engineering, plant genetic improvement, angiosperms/flowering plants, etc., can solve the problems of large proportion of G-type lignin, thick stems, value impact, etc.

Inactive Publication Date: 2014-10-08
INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the stalk of Caragana caragana is thick and hard, and the proportion of G-type lignin is too large, which affects its value in industrial pulping and feeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Caragana korshinskii Kom. transcription factor CkMYB4 and its gene
  • Caragana korshinskii Kom. transcription factor CkMYB4 and its gene
  • Caragana korshinskii Kom. transcription factor CkMYB4 and its gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] Example 1. Cloning of Caragana caragana CkMYB4 gene

[0015] The one-month-old seedlings of Caragana caragana were used in the experiment, and the leaves of the Caragana seedlings were clipped and placed in a 1.5mL centrifuge tube, quickly frozen in liquid nitrogen, and stored in a -80°C refrigerator for later use. Total RNA was extracted by TRIzole method (Invitrogen), and cDNA was obtained by reverse transcription using reverse transcription reagents (see Kit DRR019A, TaKaRa, Treasure Bioengineering Dalian Co., Ltd. for specific operations). The above reverse-transcribed cDNA product was used for nested PCR with the following primers.

[0016] MYB4-1ATGGGMMGGTCHCCKTGY

[0017] MYB4-2GTGTTCCARTARTTCTTWATYTCRTTR

[0018] MYB4-3CTCACACAAACAAAGGDGCRT

[0019] MYB4-4TTCCAATAGTTCTTDATYTCRTTRT

[0020] PCR amplification conditions:

[0021] MYB4-1 and MYB4-2 were used as primers for the first round of PCR.

[0022]

[0023] The first round of PCR product was diluted...

Embodiment 2

[0042] The construction of the CkMYB4 plant expression vector was carried out by conventional molecular biology methods, and the full-length ORF of the CkMYB4 gene was excised from the pEASY-Blunt-T vector by using the XhoI and SalI restriction sites added by the primers, and connected into the plant with the CaMV35S promoter In the expression vector PBI-xs, a binary expression vector was obtained, and after PCR and enzyme digestion identification, it was transformed into Agrobacterium GV3101, and after the plasmid was extracted and PCR, enzyme digestion was identified correctly, wild-type Arabidopsis thaliana was transformed by flower dipping method ( Columbia type, Col), the transgenic Arabidopsis was screened by Kan resistance on the plant expression vector PBI-xs, and screened and identified by PCR ( figure 1 ,2).

Embodiment 3

[0043] Example 3. Detection of lignin synthase-related gene expression in CkMYB4 gene-transferred Arabidopsis

[0044] The expression levels of genes related to lignin synthesis in Arabidopsis were detected by fluorescent quantitative PCR technology. The internal reference gene primers were designed according to the Arabidopsis EF1α gene sequence published in the GeneBank database.

[0045] F-AtEF1α-RT: AGAAGGGTGCCAAATGATGAG

[0046]F-AtEF1α-RT: GGAGGGAGAGAGAAAGTCACAGA

[0047] use Green I fluorescent dye method, on the LightCycler480 (Roche Diagnostics) real-time fluorescent quantitative PCR instrument, carry out the transcriptional expression level analysis of gene, 2 -△△Ct method to analyze the data. Results The expression levels of Arabidopsis lignin synthesis-related gene AtCAD1 were significantly increased in the five transgenic lines detected, while the expression levels of AtCAD5 and AtPAL1 were also increased in most of the transgenic lines ( image 3 ). This s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a new CkMYB4 transcription factor and its gene. The gene originates from Leguminosae Caragana shrubs Caragana korshinskii Kom., and codes R2R3 MYB transcription factors. The full length cDNA sequence of the gene comprises 1106bps, comprises a 798bp open reading frame, and codes 266 amino acids. The cDNA sequence obtained after cloning is used for constructing a plant expression vector, and the vector is transformed into wild Arabidopis thaliana to obtain a transgenic plant. Transgenic Arabidopis thaliana lignin synthetase gene and lignin content detection results show that the gene provided by the invention can change the expression of the plant lignin synthesis gene and the lignin content.

Description

technical field [0001] The invention relates to a MYB transcription factor. Specifically, the present invention relates to a gene encoding a MYB transcription factor derived from the leguminous shrub plant Caragana korshinskii Kom., named CkMYB4. The present invention also relates to the amino acid sequence of the transcription factor encoded by the gene, the carrier containing the gene, and the application of the gene in lignin genetic engineering. Background technique [0002] Lignin is an aromatic polymer widely present in vascular plants, mainly derived from hydroxycinnamyl alcohol, and widely distributed in vascular plants. 20%-30% of the biomass of vascular plants is lignin, which is the second largest type of organic matter after cellulose and the largest type of secondary metabolites. Lignin mainly exists in the secondary wall of plants, and it is covalently bonded with cellulose and hemicellulose, which increases the strength and rigidity of the cell wall and enab...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00
Inventor 李国婧李高王瑞刚杨杞齐力旺
Owner INNER MONGOLIA AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com