Sorb cold-resistant transcription factor PubHLH and application thereof
A technology of transcription factors and transgenic plants, which is applied in bHLH family transcription factors PubHLH, sorrel cold-resistant transcription factors PubHLH and their application fields, can solve the problems of spending a lot of creative labor, reduce agricultural production costs, improve cold resistance, and realize Environmentally friendly effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1 PubHLH gene cloning and expression analysis
[0029] RNA was extracted from sorbus leaves under low-temperature treatment at 4°C and reverse-transcribed, and the resulting first-strand cDNA was used to amplify the full-length PubHLH gene. Amplified gene PubHLH primer pair is: Forward primer: PubHLH Forward, 5'-TT GCTGCC ATGCTGCCGAGGCTGAACGGTGGTG-3' (SEQ ID NO: 3); reverse primer: PubHLH Reverse, 5'-GG GGTACC CTACACCATGCCATGGAACCCG-3' (SEQ ID NO: 4). The 50 μl reaction system included 100 ng cDNA, 1× buffer (TransStart FastPfu Buffer), 10 mM dNTP, 1U Taq polymerase (TransStart FastPfu DNA Polymerase) (the aforementioned buffer and Taq polymerase were purchased from TRANS), 1.0 μM of the above primers . The PCR reaction was completed on the Roche480 (Applied Biosystem) amplification instrument according to the following procedures: 95°C, 1 minute, denaturation at 95°C for 20 seconds, annealing at 58°C for 20 seconds, extension at 72°C for 60 seconds,...
Embodiment 2
[0031] Example 2 PubHLH Gene Subcellular Localization, Transcription Activation Analysis
[0032] Since the PubHLH gene has a nuclear localization signal (NLS), the present invention utilizes onion epidermis to study the subcellular localization of the PubHLH gene. The entire ORF reading frame of the PubHLH gene was amplified by RT-PCR, and two restriction sites, NcoI and SpeI, were added to the two ends of the amplification primers. Its amplification primer is (forward primer PubHLH-F1: 5'- CCATGG ATGCTGCCGAGGCTGAACGGTGGTG-3' (SEQ ID NO: 11); reverse primer PubHLH-R1: 5'-GG ACTAGT CACCATGCCATGGAACCCGAT CAA-3' (SEQ ID NO: 12), firstly digest the amplified product. At the same time, pCAMBIA1302 was digested with NcoI and SpeI, and the product was recovered and ligated to obtain the pCAMBIA1302-PubHLH-GFP recombinant vector, which was transformed into Agrobacterium EHA105. Agrobacterium infection of onion epidermis is carried out as follows: (1) draw a plate, pick a single ...
Embodiment 3
[0033] Embodiment 3 Plant Transformation Overexpression Vector Construction
[0034] According to the analysis of the multiple cloning site of pMV vector (patent application number 201210258254.4) and the restriction site on the coding region sequence of PubHLH gene, Xhol and KpnI were selected as endonucleases. First, the clone of the PubHLH gene will be used as a template for PCR amplification (amplification primer pair forward primer: PubHLH Forward, 5'-TT GCTGCC ATGCTGCCGAGGCTGAACGGTGGTG-3' (SEQ ID NO: 3); reverse primer: PubHLH Reverse, 5'-GG GGTACC CTACACCATGCCATGGAACCCG-3' (SEQ ID NO: 4), followed by enzyme digestion of the PCR product together with the pMV vector at 37°C, purification and recovery after enzyme digestion for 3-4 hours. The ratio of PubHLH gene to vector pMV in the ligation reaction system is 3:1, the total reaction volume is 10 μl, 10×T4 ligation buffer 1 μl, T4 ligase 1 μl, 16°C for 13-16 hours. The ligation product was transformed into Escherichia ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com