An expression device for secreting and expressing foreign protein in Aspergillus oryzae cells and its genetic engineering bacteria of Aspergillus oryzae

A technology for genetically engineered bacteria and exogenous proteins, applied in the field of Aspergillus oryzae genetically engineered bacteria, can solve the problems of low expression of exogenous proteins, difficulty in separation and purification, etc., and achieve the effects of stable expression, efficient secretion and expression, and easy separation and purification.

Active Publication Date: 2017-11-28
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a kind of expression equipment and its Aspergillus oryzae genetically engineered bacteria for secreting and expressing exogenous protein in Aspergillus oryzae cells, thereby solving the problem of low foreign protein expression in the Aspergillus oryzae filamentous fungus expression system in the prior art Defects of difficult separation and purification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An expression device for secreting and expressing foreign protein in Aspergillus oryzae cells and its genetic engineering bacteria of Aspergillus oryzae
  • An expression device for secreting and expressing foreign protein in Aspergillus oryzae cells and its genetic engineering bacteria of Aspergillus oryzae
  • An expression device for secreting and expressing foreign protein in Aspergillus oryzae cells and its genetic engineering bacteria of Aspergillus oryzae

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0037] The preparation method of the expression device of the present invention is as follows:

[0038] (1) Through PCR amplification, the promoter of Aspergillus oryzae α-amylase (PamyB+signal peptide, PaS) containing the secretory peptide sequence, an exogenous amylase gene (GpA2), and the terminator of Aspergillus oryzae α-amylase were respectively obtained. The respective DNA sequences of the child (TamyB) and orotate phosphoribosyltransferase gene screening marker expression cassette.

[0039] (2) The fusion sequence (PaSA2) obtained by fusion PCR of the promoter, the signal peptide sequence (PaS) and the amylase gene (GpA2), the terminator (TamyB), orotate phosphoribosyltransferase gene screening marker expression cassette , PaSA2 were sequentially connected to the expression vector pBC-Hygro, and the recombinant expression vector 1 was constructed, namely pBC12FA2; the expression vector 2, namely pBC12NHA2, was obtained by inserting the 6×His-Tag purification tag throug...

Embodiment 1

[0068] Embodiment 1. comprises the construction of the expression vector of Aspergillus oryzae expression equipment of the present invention

[0069] 1.1. Extraction of Aspergillus oryzae genome

[0070] Aspergillus oryzae RIB40 (National Research Institute of Brewing Stock Culture, ATCC42149) was inoculated on CM medium, and incubated at 30°C for 7 days until the spores matured. Prepare an appropriate amount of spore suspension and inoculate it in CM medium liquid seed medium, and cultivate it at 30°C and 200rpm for 2 days until the mycelium concentration reaches 4-5g / L for genome extraction. The method refers to the instructions of the Omega fungal genome extraction kit. .

[0071] 1.2. Isolation of Aspergillus oryzae α-amylase promoter (PamyB) and its signal peptide sequence

[0072] According to the sequence of the amyB promoter released on GeneBank, the above-mentioned extracted Aspergillus oryzae genomic DNA was used as a template, and the upstream primer PaXf and the ...

Embodiment 2

[0111] Embodiment 2. Utilize Aspergillus oryzae expression equipment to express green fluorescent protein

[0112] 2.1. Amplification of the green fluorescent protein gene

[0113] Using the plasmid pMD19-T simple vector linked to the green fluorescent protein GFP (NCBI GenBank accession number: AY013824) as a template, the 717bp (including restriction site) enhanced green was amplified by PCR using primers GFPNf / GFPHr fluorescent protein gene. The primer sequences are:

[0114] GFPNf: CACTA GCTAGC ATGAGTAAAGGAGAAGAAC, which contains the NheI restriction site;

[0115] GFPHr: CCC AAGCTT TTATTTGTATAGTTCATCCATG, which contains the HindIII restriction site.

[0116] The length of the amplified product and the results of sequence analysis were in line with expectations.

[0117] 2.2. Connection between GFP and expression equipment

[0118] The above-mentioned amplified product (GFP gene) was digested with NheI and HindIII restriction enzymes, and connected to the expres...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention provides a kind of expression equipment for secreting and expressing exogenous protein in Aspergillus oryzae cells and the Aspergillus oryzae genetically engineered bacterium thereof, and the expression equipment comprises from 5' to 3' in sequence: (1) controlling exogenous gene in Aspergillus oryzae The promoter of transcription; (2) the coding sequence of the signal peptide that controls the secretion and expression of foreign protein in Aspergillus oryzae; (3) the coding sequence of the tag used for affinity purification of foreign protein; (4) multiple cloning site; (5) the terminator that controls exogenous gene to terminate transcription in Aspergillus oryzae; (6) is used for the expression box of the Aspergillus oryzae orotate phosphoribosyltransferase gene of plasmid transformation screening marker, its coding sequence is as shown in SEQ ID: 2 Show. The expression equipment uses auxotrophic gene screening markers to increase the positive rate of transformation, shorten operation time and workload, and is suitable for the secretion and expression of most foreign genes; the Aspergillus oryzae genetically engineered bacteria can efficiently express acidic and neutral amylases. The paper and textile industries have important applications.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically relates to an expression device for exogenous protein secreted and expressed in Aspergillus oryzae cells and an Aspergillus oryzae genetically engineered bacterium. Background technique [0002] Aspergillus oryzae (Aspergillus oryzae) is a commonly used strain in the fermentation industry. Mycelium is generally yellow-green, then yellowish brown; Aspergillus oryzae mycelium is composed of multi-cells and is a strain that produces complex enzymes. In addition to protease, it can also be used to secrete amylase, cellulase, pectinase, glycoside enzymes, lipases, peptidases, and phytases; among them, the industrially common peak amylase (TAA) is the α-amylase derived from Aspergillus oryzae. Aspergillus oryzae is a safe microorganism (GRAS) recognized by the FDA. It is widely used in brewing, condiment, feed manufacturing, textile, paper, pulp and other industrial fields, and has b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/80C12N1/15C12P21/00C12R1/69
Inventor 魏东芝高蓓毛佑志
Owner EAST CHINA UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap