Eukaryotic expression vector containing attenuated SV40 promoter/dihydrofolate reductase expression element, and construction method thereof
A technology of eukaryotic expression vector and dihydrofolic acid, applied in the field of genetic engineering vector, can solve the problem of time-consuming and labor-intensive, and achieve the effect of ensuring universality, easy recombination operation and moderate size
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0097] Embodiment 1, the construction of eukaryotic expression vector pCMV-WD
[0098] (1) Design a weakened SV40 promoter / DHFR expression element
[0099] According to the method reported by Zenke M, et al in EMBO J.1986 February; 5(2):387-397., the SV40 promoter was weakened: the natural SV40 promoter contains two repeated 72bp enhancers The sequence, namely: GGTGTGGAAAGTCCCCCAGGCTCCCCAGCAGGCAG AAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCA, the author deleted the first enhancer sequence, and at the same time mutated the sequence TGG at positions 5-7 in the second enhancer sequence to GTT, resulting in a weakened SV40 promoter of 346 nucleotides sequence.
[0100] According to the pSV2-dhfr vector purchased from ATCC (number: 67110), the 564-nucleotide DHFR coding gene sequence was determined.
[0101] Based on past work experience, the inventor designed a 43-nucleotide junction sequence located between the SV40 promoter and the DHFR gene, connecting the weakened SV40 promoter, th...
Embodiment 2
[0121] Example 2. Using pCMV-WD plasmid to express Plasmodium falciparum sporangia surface membrane protein Pfs25Pfs25 target gene and primer synthesis
[0122] In the previous work, based on the Pfs25 gene information published in GenBank (GenBank locus: X07802), the author selected the DNA sequence corresponding to amino acids 23 to 193 of the complete pfs25 protein as the target gene. In this study, primers were designed using the primer synthesis software Primer premier5.0.
[0123] Pfs25 upstream primer:
[0124] GCAA gatatc ACACCATG AAAG TAACAGTCGATACTGTGTGTAAGAGAGGCTTCCT
[0125] The underline is the EcoR V restriction site, and the sequence in italics corresponds to the signal peptide: GVKVLFALICIAVAEA;
[0126] Pfs25 downstream primers:
[0127] TGAT ctcgag TTAAGTACATATTGATGA
[0128] The underline is the Xho I restriction site.
[0129] The target gene and primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. PCR conditions: 95°C, 4min; 95°...
Embodiment 3
[0142] Example 3, using pCMV-WD plasmid to express human nerve growth factor β subunit (β-hNGF)
[0143] Synthesis of β-hNGF gene and primers
[0144] Primers were designed according to the β-hNGF gene sequence (Accession No.: NM_002506) published in GenBank, and the upstream and downstream primers were synthesized by Shanghai Sangon Co., Ltd. The sequence is as follows: hNGF primer: P(s): 5’AGG GATATCACACCATGTCCATGTTAT 3' (underlined is EcoR V restriction site), P(a): 5'TG GGATCC GGTCAGGCTCTTCTC 3' (the underline is the restriction site of BamH I)
[0145] pUC18-β-NGF is provided by the National Institute for the Control of Pharmaceutical and Biological Products, which contains the full-length fragment of β-hNGF encoding 241 amino acids (including N-terminal 18 amino acid signal peptide). Using pUC18-β-NGF as a template, primers P(s) and P(a) amplify human nerve growth factor β subunit (β-hNGF) gene. PCR conditions: 95°C, 4min; 95°C, 60 seconds, 55°C, 60 seconds, 72°C, ...
PUM
Property | Measurement | Unit |
---|---|---|
wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com