Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Susceptible noninvasive detection kit for hypertension (genes like GNB3)

A high blood pressure, kit technology, applied in the field of molecular biology, can solve problems such as increasing the risk of hypertension

Inactive Publication Date: 2014-04-09
解码(上海)生物医药科技有限公司
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the single-gene analysis of the Han population, no direct correlation between the C825T gene polymorphism of the GNB3 gene and hypertension has been found, but the 825T allele of the GNB3 gene can significantly increase the risk of hypertension in the carriers of the 235T allele of the GNB3 gene. risk of disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1. Use of detection kits.

[0021] 1. Extract DNA template

[0022] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0023] 2. PCR amplification reaction

[0024] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0025] (1) GNB3 (C825T) forward primer: 5'TTCCTGCCGCTTGTTTGA3'

[0026] GNB3 (C825T) reverse primer: 5'AAATGCCAGGAACCCAGAA3'

[0027] (2) MTHFR (C677T) forward primer: 5'AGGGAGGCTTCAACTACGC3'

[0028] MTHFR (C677T) reverse primer: 5'GCGGTTGAGGGTGTAGAAGT3'

[0029] (3) TGF-Β1 (T869C) forward primer: 5'TTTCCGTGGGATACTGAGACA3'

[0030] TGF-Β1 (T869C) reverse primer: 5'GCTTCCGCTTCACCAGCT3'.

[0031] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5ul; 25mM dNTP mixture 0.2ul, 5U / ul Taq enzyme 0.125ul, DNA template 1ul (about 12-15ng), 20uM forward primer and reverse primer Each 0.25ul, ...

Embodiment 2

[0046] Example 2. The service of non-invasive detection of genes for the prevention of hypertension for the population.

[0047] 1. Sampling and DNA extraction

[0048] The physicians in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral epithelial cells, and the phenol-chloroform method was used to extract DNA from oral epithelial cells.

[0049] 2. Genotype detection

[0050] Using the kit provided by the present invention, three single nucleotide polymorphisms of C825T (rs5443) on the GNB3 gene, C677T (rs1801133) on the MTHFR gene, and T869C (rs1982073) on the TGF-B1 gene of the subject's genomic DNA The loci were subjected to DNA sequencing to determine the genotypes of the three SNPs loci.

[0051] 3. Risk assessment and analysis of high-risk groups with hypertension

[0052] Through the analysis of the SNPs genotype of the subjects, a hypertension risk assessment analysis report is issued. The report details the genetic t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a susceptible gene noninvasive detection kit for hypertension. The kit comprises a specific primer and a DNA sequencing primer of the pleomorphic locus gene type of three mononucleotides which comprise C825T(rs5443) on a GNB3 gene, C667T(rs1801133) on an MTHFR gene and T869C(rs1982073) on a TGF-B1 gene, a PCR reaction assembly, a PCR product purifying assembly and a DNA sequencing reaction assembly. The kit assesses a risk level of hypertension at the genetic level by detecting the pleomorphic locus gene type of three mononucleotides which are closely related to hypertension, and guides the population to prevent generation of the disease in advance. A sampling method comprises sampling by oral mucosa cells without pain and wound, and avoids cross infection. The gene noninvasive detection kit has advantages of accurate and reliable sequencing detection result, no need of expensive special Import Instrument, and easy popularization.

Description

technical field [0001] This project belongs to the field of molecular biology, involves medicine and biotechnology, and specifically involves a detection kit for hypertension susceptibility genes, which evaluates the risk level of hypertension from the genetic level according to the detection results, and serves as a direction for the prevention and treatment of hypertension guide. Background technique [0002] Hypertension refers to a syndrome in which arterial systolic and / or diastolic blood pressure increases in resting state as the main clinical manifestation, and can be divided into primary hypertension of unknown etiology and secondary hypertension caused by a definite independent disease . Among them, patients with essential hypertension accounted for more than 95% of the total number of hypertensive patients. According to survey results, 59% of patients with essential hypertension have a family history, indicating that genetic factors have an important impact on th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/156
Inventor 石慧林
Owner 解码(上海)生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com