Supercharge Your Innovation With Domain-Expert AI Agents!

Plant pollen development specific promoter and application thereof

A plant pollen and promoter technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, etc., can solve the problem that there is no promoter specifically expressed in the development of cloned pollen, and achieve good application prospects

Inactive Publication Date: 2014-02-26
BEIJING UNIV OF AGRI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The promoter specifically expressed by this pollen development has not been cloned yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant pollen development specific promoter and application thereof
  • Plant pollen development specific promoter and application thereof
  • Plant pollen development specific promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach

[0017] The plant pollen development-specific promoter of the present invention, its preferred embodiment is:

[0018] Including the following nucleotide sequences:

[0019] ·AATTCATTACATATAACAGCGCCGTAATAACTTGGATCTCATCTATACGTGTGTGAGTTGTAGATATATAA ACAAAATTTATTTTCATTTGTGAAAAAAATATTTATACTAGATTTTTAGATGTGGAAATAGTGCAACAAGC AAAAAGTTACAAATAAAAGAAAATGTGGAAATATGAGGTATAAAATAAAATAGAGAACTAGGACTAGGAGA CTTGTTACTTTGTTAGTGCATGTAGTGGTAAATAACATAAAGTCCATTCAGAACTAGACTATTCTCACCTC TCCAACAATGAACTTAATATAGGCTGCTGGCCTGTTGTGGCCCAGAAAAAGTTAAAGAAGAACAACAAAAA CATGAATTCATTTCCGGTATAAGGTGAAAGATACACATGAAAAATGGTGAGTAGCGTTCAGAAAAGGAAAA GTAACTCAATAGTACAAAAGAAAATCTATTTCCACAATACAAAATAAAACTCATTAATCATGTAGTATCCT TTTTCCTAAATTTCATATTGGATTAATCTTTTAATTTTTTGGTTTGATTGGTAGATCTATGTAATGCATGT ATACCACTTTAACACAAACCTTTTTTCTTACAATTTTTCTTTATGTATTTATTTTTGGTTGGTTTTTATCC CAAAACAGACTAATACAATGCGTGTGTGATGCTTTCACTCTTTCTCAAGCACAATCCGCCTAGACTATGGT CACGTATTCACTCATTTCTTCTTTACTTATTAAAATGTAAAAAATCTGATTAATAATTTTCATTTAATTCT TGCTTTGTCTTTTCATCACCAAACTCA...

specific Embodiment

[0024] Concrete embodiment, as shown in the table below:

[0025]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant pollen development specific promoter and an application thereof. The promoter has a full length of 1140 bases, and is used for starting gene expression at the plant pollen mononuclear microspore phase and at the matured pollen grain phase, wherein the expression is only carried out in tapetal layers and pollen. The promoter has good application prospects on genetic engineering breeding, is helpful for understanding biological phenomena of pollen development and male sterility, provides a new regulatory element for plant male sterility genetic engineering, and provides theoretical basis and application guidance for effective control of plant fertility performance, and rapid acquisition of production-available male sterile lines.

Description

technical field [0001] The present invention relates to a transcriptional gene promoter, in particular to a plant pollen development specific promoter and application thereof. Background technique [0002] Plant male sterility refers to the phenomenon that the abnormal anthers of hermaphrodite plants lead to the loss of pollen function, which is common in angiosperms. Breeding male sterile lines using the male sterility characteristics of plants is an important means to simplify the seed production procedure and reduce the cost of seed production in the utilization of crop heterosis. Brassicaceae crops are the most common type of heterosis utilization, male sterile line is an ideal system for producing a generation of hybrids. From the perspective of developmental molecular biology, pollen abortion is the phenotypic manifestation of male sterility in plants. Understanding the whole process and molecular mechanism of pollen development is the basis and key to the study of ma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113
Inventor 韩莹琰范双喜程继鸿宋婷婷田佶杨凯
Owner BEIJING UNIV OF AGRI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More