Supercharge Your Innovation With Domain-Expert AI Agents!

Kit for detecting hotspot mutation of KRAS gene and detection method thereof

A kit and gene technology, which is applied in the field of kits for detecting KRAS gene hot spot mutations, can solve problems such as limiting the application of Sanger sequencing method, and achieve the effects of short operation time, simple operation, and improved sensitivity

Active Publication Date: 2014-02-12
WUHAN BIOTECH GENE ENG
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In tumor tissue, KRAS wild-type cells and mutant cells are mixed, and the sensitivity of Sanger sequencing method is only 10-20%, that is, when mutant cells account for 10-20% of the total detected cells, it can be detected, so it is extremely important. Limits the application of Sanger sequencing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting hotspot mutation of KRAS gene and detection method thereof
  • Kit for detecting hotspot mutation of KRAS gene and detection method thereof
  • Kit for detecting hotspot mutation of KRAS gene and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] 1. Synthesis of primers and probe sequences and synthesis of PNA sequences in the PCR reaction solution in the kit

[0034] According to the requirements of KRAS gene hotspot mutation region and sequencing fragments (see figure 1 ), design the following primers, probes and PNA, and synthesize the following primers, probes and PNA by artificial synthesis:

[0035] KRAS12F: ACTGGTGGAGTATTTGATAGTGTA (SEQ. ID NO. 1)

[0036] KRAS12R: CTTTATCTGTATCAAAGAATGGTCCTG (SEQ. ID NO. 2)

[0037] KRAS12P: FAM-ACCTTATGTGTGACATGTTCTAATATAGT-BHQ1 (SEQ. ID NO. 3)

[0038] KRAS12PNA: GGAGCTGGTGGCGTAGGC (SEQ. ID NO. 4)

[0039] The above primers, probes and PNA sequences are all from the 5' end to the 3' end, 12 indicates the codon number of the KRAS mutation hotspot region, F indicates the forward primer, R indicates the reverse primer, P indicates the probe, and FAM indicates the middle of the probe. Fluorescent group, BHQ1 represents a quenching group.

[0040]Insert the universal M...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology and discloses a kit for detecting the hotspot mutation of KRAS gene and a detection method thereof. The kit comprises a PNA (peptide nucleic acid) reagent; and the wild type KRAS gene sequence is closed by a clamp technology so as to improve the sensitivity of a sanger sequencing process and the detection rate of the KRAS gene mutation. The detection method disclosed by the invention is simple and safe to operate and does not need many expensive reagents, thereby being economical and efficient; and meanwhile, the detection method also has the advantage of short operation time, and the whole detection process is finished within 4-6 hours.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a kit for detecting KRAS gene hot spot mutation and a detection method thereof. Background technique [0002] There are three genes in the RAS gene family related to human tumors: HRAS, KRAS and NRAS, which are located on chromosome 11, 12 and 1, respectively. KRAS is also known as the p21 gene because it encodes a 21kD ras protein. Among the RAS genes, KRAS has the greatest impact on human cancer. It acts like a molecular switch: when normal, it controls the pathways that regulate cell growth; when abnormal, it causes cells to continue to grow and prevents cells from self-destruction. She is involved in intracellular signal transmission. When the KRAS gene is mutated, the gene will be permanently activated, unable to produce normal RAS protein, causing intracellular signal transduction disorder, cell proliferation uncontrolled and cancerous. [0003] The KRAS gene can ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6848C12Q1/686C12Q1/6886C12Q2525/107C12Q2600/156C12Q2531/113
Inventor 叶伦李雪梅付金玲陈刚
Owner WUHAN BIOTECH GENE ENG
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More