Supercharge Your Innovation With Domain-Expert AI Agents!

Method for authenticating whether to-be-detected variety is Ruiza816 and special primer group thereof

A primer set and Ruizha technology, applied in the field of identifying whether the tested variety is Ruiza 816, can solve the problems of poor seed quality, adulteration of female parent, long time, etc., and achieve fast speed, intellectual property protection, and clear map. Effect

Active Publication Date: 2014-02-05
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the hybrid seed production of cotton is still dominated by artificial seed production, and the sterile line seed production has not been promoted. With the continuous rise of labor costs, the cost of hybrid seed production is getting higher and higher, and the quality of seeds is getting worse. The hybrid cotton seeds sold are seriously fake, with F 2 Replace F 1 , with regular cotton instead of F 1 , there are phenomena such as female parent doping, so that the hybrids cannot achieve the due effect of increasing production in the promotion, and affect the promotion effect of hybrid cotton
Conventional field identification takes a long time, which will affect the sales of seeds in the current year, and the identification effect is not very satisfactory due to the impact of the environment during the Jiadai identification in Hainan

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for authenticating whether to-be-detected variety is Ruiza816 and special primer group thereof
  • Method for authenticating whether to-be-detected variety is Ruiza816 and special primer group thereof
  • Method for authenticating whether to-be-detected variety is Ruiza816 and special primer group thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1, Construction of the DNA Fingerprint of Ruiza 816

[0034]1. Screening of SSR primer pairs

[0035] After screening a large number of cotton SSR primers, it was found that 15 SSR primer pairs (see Table 1 for the nucleotide sequence) could be used to make the DNA fingerprint of Ruiza 816.

[0036] Nucleotide sequences of table 115 primer pairs

[0037] serial number

Forward primer (5'→3')

Reverse primer (5'→3')

1

CS62 primer pair

GATGGCTACCTCCCCTTTGTA (sequence 1)

CGTAAGGAAGCCTAGCAAAA (sequence 2)

2

NAU1103 primer pair

GGAGCCAGAAGTTGAGAAAA (sequence 3)

TTCGGCTTCTGCTTTTACTT (sequence 4)

3

NAU1186 primer pair

AATGGTCCTGCTCCAGATT (sequence 5)

AATCGTCGTCGTCGAATTAT (Sequence 6)

4

NAU1233 primer pair

TTCGGGAAAGTTAGAGGAGA (Sequence 7)

TCCTCAGAGCTCGGAATAGT (sequence 8)

5

NAU2026 primer pair

GAATCTCGAAAACCCCCATCT (sequence 9)

ATTTGGAAGCGAAGTACCAG (Seque...

Embodiment 2

[0085] Example 2, Application of the DNA Fingerprint of Ruiza 816

[0086] Using the genomic DNA of Ruiza 816, Zhongzhimian 2 or Lumianyan 28 as templates, 15 SSR primer pairs were used for PCR identification, followed by 8% polyacrylamide gel electrophoresis and silver staining.

[0087] The PCR system was 10.0 μL, containing 0.5U Taq enzyme, and the concentrations of the forward primer and the reverse primer were both 0.5 μM.

[0088] PCR reaction program: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 s, annealing at 56°C for 45 s, extension at 72°C for 45 s, 30 cycles; denaturation at 94°C for 1 min, annealing at 56°C for 45 s, extension at 72°C for 2 min, and storage at 4°C.

[0089] The parameters of polyacrylamide gel electrophoresis are as follows: the sample volume per well is 1.8 μL; 200v voltage, 50min.

[0090] The results are shown in Table 4.

[0091] Table 4 The results of this embodiment (band type)

[0092]

[0093] Using the CS62 pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for authenticating whether a to-be-detected variety is Ruiza816 and a special primer group thereof. The method provided by the invention comprises the step of carrying out PCR (polymerase chain reaction) amplification by taking the gene group DNA of to-be-detected cotton as a template and by adopting a CS62 primer pair, an NAU1103 primer pair, an NAU1186 primer pair, an NAU1233 primer pair, an NAU2026 primer pair, an NAU2274 primer pair, a CIR062 primer pair, an NAU1071 primer pair, an NAU1085 primer pair, an NAU1102 primer pair, an NAU1196 primer pair, an NAU1255 primer pair, an NAU1369 primer pair, an NAU2173 primer pair and an NAU2277 primer pair, wherein if PCR amplification products meet the requirements of 13 items above from standard (1) to standard (15), the to-be-detected cotton is Ruiza816. According to the invention, the seed production quality of Ruiza816 is monitored, the quality of sold Ruiza816 seeds is ensured, counterfeit Ruiza816 seeds are controlled, the intellectual property of a breeding person is protected, and the variety right is protected.

Description

technical field [0001] The invention relates to a method for identifying whether a variety to be tested is Ruiza 816 and a special primer set thereof. Background technique [0002] Cotton has obvious heterosis. Hybrid cotton varieties have been used for many years, and the effect of increasing yield is obvious, and they have been popularized and applied in a large area. At present, the hybrid seed production of cotton is still dominated by artificial seed production, and the sterile line seed production has not been promoted. With the continuous rise of labor costs, the cost of hybrid seed production is getting higher and higher, and the quality of seeds is getting worse. The hybrid cotton seeds sold are seriously fake, with F 2 Replace F 1 , with regular cotton instead of F 1 , There are phenomena such as female parent doping, so that the hybrids cannot achieve the due effect of increasing production in the promotion, and affect the promotion effect of hybrid cotton. Co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/156
Inventor 付小琼杨付新王秀玲陆许可叶武威
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More