Populus deltoides*Populus nigraPdHARDY gene and application thereof

A gene, European and American technology, applied in the field of PdHARDY gene, to achieve the effect of improving expression

Inactive Publication Date: 2013-12-11
DALIAN NATIONALITIES UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the study of this gene in European and American poplar has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Populus deltoides*Populus nigraPdHARDY gene and application thereof
  • Populus deltoides*Populus nigraPdHARDY gene and application thereof
  • Populus deltoides*Populus nigraPdHARDY gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] The extraction of embodiment 1 total RNA

[0021] 1. The European and American Populus 107 material used in the present invention is taken from Baoding, Hebei. It is an annual cutting cuttage cultivated in the nursery of Beijing Forestry University. After the cuttage, it is watered once every three days in order to keep the soil moist. After new leaves grow, the growth similar (Growing for 3 months) European and American poplar seedlings were sprayed with 250mM NaCl, and the top leaves were removed at 0, 2, 4, 6, and 12 hours respectively, placed in liquid nitrogen, and then stored in a -80°C ultra-low temperature refrigerator for later use. For total RNA extraction and cDNA synthesis.

[0022] 2. The process of extracting total RNA from the leaves of Populus americana under 250mM NaCl stress by CTAB method:

[0023] (1) Before extracting RNA, add DTT at a final concentration of 0.1 mM to 2×CTAB buffer, and preheat at 65°C.

[0024] (2) Put 0.5 g of liquid nitrogen gr...

Embodiment 2

[0030] Example 2 Using fluorescent quantitative PCR method to detect the expression of PdHARDY gene of Populus americana in adversity

[0031] According to the conserved sequence of PdHARDY gene of Populus americana, the upstream primer of specific primers: PdHARDY1 (SEQ ID NO.1) and downstream primer: PdHARDY2 (SEQ ID NO.2) were designed.

[0032] Primer name

sequence name

Base sequence (5'--3')

PdHARDY1

SEQ ID NO.1

ATGCAAGATT ATCAACAAAG CAGAATC

PdHARDY2

SEQ ID NO.2

TCAAGGGAATTTCCAAAGGTTCTGGTC

[0033]According to the method of Example 1, the cDNA samples prepared by extracting the apical leaves at 0, 2, 4, and 6 hours were used as templates, and PdHARDY1 (SEQ ID NO.1) and PdHARDY2 (SEQ ID NO.2) were used as templates. Primers were used for fluorescent quantitative PCR analysis.

[0034] The fluorescent quantitative PCR reaction system (20 μL):

[0035]

[0036] The fluorescent quantitative PCR reaction is divided int...

Embodiment 3

[0038] Example 3 Clone PdHARDY gene of Populus americana by PCR method

[0039] According to the conserved sequence of PdHARDY gene of Populus americana, the upstream primer of specific primers: PdHARDY1 (SEQ ID NO.1) and downstream primer: PdHARDY2 (SEQ ID NO.2) were designed.

[0040] Primer name

sequence name

Base sequence (5'--3')

PdHARDY1

SEQ ID NO.1

ATGCAAGATT ATCAACAAAG CAGAATC

PdHARDY2

SEQ ID NO.2

TCAAGGGAATTTCCAAAGGTTCTGGTC

[0041] The synthetic cDNA prepared by the method described in Example 1 was used as a template, and PdHARDY1 (SEQ ID NO.1) and PdHARDY2 (SEQ ID NO.2) were used as primers for PCR reaction;

[0042] The PCR reaction system is (25 μl):

[0043]

[0044]

[0045] The PCR reaction program is as follows: 35 cycles of pre-denaturation at 95°C for 5 min, each cycle of denaturation at 95°C for 50 s, annealing at 63°C for 90 s, extension at 72°C for 2 min, and finally, the sample was extended at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a stress related gene PdHARDY of Populus deltoides*Populus nigra, and the stress related gene PdHARDY plays an important role in the salt resisting process of a plant. The stress related gene is named as PdHARDY and has a base sequence as shown in SEQ ID NO:3 in a sequence table. When the stress related gene PdHARDY is constructed in an expression vector pCAMBIA1304, a promoter is added before the transcription initiation nucleotide of the stress related gene PdHARDY, and a selectable marker GFP (Green Fluorescent Protein) is added for conveniently identifying and screening transgenic plant cells or plants; the expression vector carried with the stress related gene PdHARDY can transform plant hosts through multiple methods and be used for culturing salt-resistant plant species. The stress related gene PdHARDY disclosed by the invention has a wide application prospect in culturing salt-resistant plants.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a PdHARDY gene from Populus deltoides×Populus nigra and its application. Background technique [0002] European and American poplar (Populus deltoides×Populus nigra) is one of the most suitable tree species for short-rotation industrial timber intensive management in mid-latitude regions. In recent years, many excellent European and American poplar clones have been introduced into our country to create large-scale fast-growing and high-yielding forests and have achieved good economic and social benefits. But high salt etc. limit its further popularization. Therefore, when it is introduced into high-salt and water-scarce areas, screening and cultivating salt-resistant strains is a prerequisite. With the development of molecular biology, it has become an important way to solve this problem by using molecular biology techniques to study the molecular mechani...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/11C07K14/415C12N15/82C12N1/21C12R1/19C12R1/01
Inventor 郭鹏董燕
Owner DALIAN NATIONALITIES UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products