Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker closely linked with major gene locus of grain weight of wheatear as well as acquiring method and application of molecular marker

A technology of molecular markers and main effect genes, which is applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., to achieve the effect of improving selection efficiency and quality, fast and accurate screening, and accelerating the selection process

Inactive Publication Date: 2013-12-11
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For decades, great progress has been made in improving wheat yield by increasing the number of ears and thousand-grain weight, and it is difficult to make further breakthroughs at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker closely linked with major gene locus of grain weight of wheatear as well as acquiring method and application of molecular marker
  • Molecular marker closely linked with major gene locus of grain weight of wheatear as well as acquiring method and application of molecular marker
  • Molecular marker closely linked with major gene locus of grain weight of wheatear as well as acquiring method and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] A molecular marker closely linked to the main effect gene locus of wheat panicle weight,

[0036] labeled primers Xcfd80.2 ,

[0037] The left end primer sequence ATAGGGGTTTTGAATCACTCC (as described in SEQ ID NO: 1),

[0038] Right end primer sequence TTGGATTTGCAGAGCCTTCT (as described in SEQ ID NO: 2)

[0039] and molecular markers Xbarc146.1 primers,

[0040] The left end primer sequence AAGGCGATGCTGCAGCTAAT (as described in SEQ ID NO:3),

[0041] Right end primer sequence GGCAATATGGAAACTGGAGAGAAAT (as described in SEQ ID NO:4)

[0042] The DNA of wheat variety Jing 411 was amplified by PCR respectively. The PCR amplification system was 20 μl, including: 1.0 μl each of the left and right primers (10 μmol / L), 10×Buffer 2.0 μl, Mg 2+ (25 mmol / L) 1.2 μl, Taq enzyme (5 U / μl) 0.2 μl, dNTP (2.5 mmol / L) 0.6 μl, DNA (30 ng / μl) 2.0 μl, and ddH for the rest 2 O supplementation; PCR amplification program: 94°C pre-denaturation for 7 min; 94°C denaturation for 30 s, 60 / 51...

Embodiment 2

[0056] Main effect gene locus provided by the invention and wheat ear grain weight QKws.cas-6A Application of tightly linked molecular markers in 10 derived lines of wheat variety Jing 411 and wheat variety Xiaoyan 54.

[0057] Using Xiaoyan 54 as the female parent and Jing 411 as the male parent, the F 7 Recombinant inbred line populations (RIL populations). labeled primers Xcfd80.2 and Xbarc146.1 Jing 411, Xiaoyan 54 and 10 derivative lines were analyzed. The specific steps are as follows:

[0058] (1) Wheat varieties Jing 411, Xiaoyan 54 and 10 derivative lines were planted in the field, and the leaves of the plants of each line were separated and extracted by the SDS method;

[0059] The derivative strain of the wheat variety Jing 411 refers to a strain obtained by using Xiaoyan 54 as the female parent and Jing 411 as the male parent through the single-seed propagation method;

[0060] (2) Using labeled primers Xcfd80.2 and Xbarc146.1 The obtained DNA was amplif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker closely linked with a major gene locus of the grain weight of a wheatear. The DNA (Deoxyribose Nucleic Acid) of a wheat variety Jing 411 is subjected to PCR (Polymerase Chain Reaction) amplification by using marker primers Xcfd80.2 and Xbarc146.1, and then, amplification products are electrophoretically separated on 8% polyacrylamide gel, so that the amplification products with the molecular weights of respectively 160bp and 142bp are obtained, i.e., the molecular marker of the major gene locus QKws.cas-6A of the grain weight of the wheatear is obtained. The molecular marker of the major gene locus of the grain weight of the wheatear, provided by the invention, can be used for detecting whether a wheat variety or strain contains the major gene locus QKws.cas-6A for increasing the grain weight of the wheatear, so that the wheat variety or strain with the gene locus is rapidly screened and used for breeding, and the breeding progress of the high-yield wheat variety can be greatly accelerated.

Description

technical field [0001] The invention relates to the application field of wheat molecular biotechnology and breeding, in particular to a molecular marker closely linked to the main gene locus for increasing wheat panicle weight and its acquisition method and application. Background technique [0002] Wheat is one of the most important food crops in the world and the second largest food crop in my country. Its high and stable yield directly affects people's living standards and national food security in our country. Improving wheat yield per unit area and cultivating high-yielding new varieties are the fundamental way out to ensure my country's total wheat production level and ensure food security. Wheat yield traits are complex quantitative traits controlled by multiple quantitative trait loci (Quantitative trait loci, QTL). , Traditional breeding methods often have the problems of long time, large consumption, high cost and small results. Molecular marker-assisted breeding...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor 许云峰安调过王瑞芳童依平刘冬成张爱民李滨
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More