Quantitative polymerase chain reaction (PCR) method capable of improving sensitivity and specificity
A specific and sensitive technology, applied in the field of quantitative PCR, to achieve the effect of good specificity, convenient use and good versatility
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] One, the reagent of the quantitative PCR reaction system of the present embodiment is as follows:
[0026] 10×Buffer (Mg 2+ free);
[0027] 10×Gelgreen I;
[0028] 10×PCR protectant (fetal bovine serum albumin);
[0029] Each 10mmol / L solution of dATP, dUTP, dGTP and dCTP;
[0030] 25mmol / L Mg 2+ ;
[0031] 5U / μL hTaq enzyme;
[0032] Sterile double distilled water.
[0033] Two, the application of the quantitative PCR method of this embodiment
[0034] (1) Preparation of DNA to be tested: DNA was extracted from mouse blood according to conventional methods, and EGF gene was amplified.
[0035] (2) Synthesis of primers.
[0036] Forward primer: TATAGATATCATGAATAGTTATCCAGGATGCCCA
[0037] Reverse primer: TATA GAATTCTCAACGCAGTTCCCCACCATCGTAG.
[0038] (3) The establishment of the PCR reaction system, the total reaction volume is 25 μL, and the reagents are added according to the table below.
[0039] Table 1 PCR reaction system
[0040] .
[0041] (4) qPC...
Embodiment 2
[0050] The reagents of the quantitative PCR reaction system of the present embodiment are as follows:
[0051] 10×Buffer (Mg 2+ free);
[0052] 10×Gelgreen I;
[0053] 10×PCR protectant (Tween 20);
[0054] Each 5mmol / L solution of dATP, dUTP, dGTP and dCTP;
[0055] 20mmol / L Mg 2+ ;
[0056] 5U / μL hTaq enzyme;
[0057] 10 μmol / L forward primer;
[0058] 10μmol / L reverse primer;
[0059] Sterile double distilled water.
[0060] The working concentration of the fluorescent dye Gelgreen I is 0.5ט1×. The working concentration of the hot start hTaq enzyme is 0.01-0.1 U / μL. The working concentration of the dATP solution, dUTP solution, dGTP solution or dCTP solution is 100-200 μmol / L.
[0061] Prepare the DNA to be tested according to the conventional method, establish the PCR reaction system, and carry out the qPCR reaction.
Embodiment 3
[0063] The reagents of the quantitative PCR reaction system of the present embodiment are as follows:
[0064] 10×Buffer (Mg 2+ free);
[0065] 10×Gelgreen I;
[0066] 10×PCR protectant (dithiothreitol);
[0067] Each 10mmol / L solution of dATP, dUTP, dGTP and dCTP;
[0068] 30mmol / L Mg 2+ ;
[0069] 5U / μL hTaq enzyme;
[0070] 10 μmol / L forward primer;
[0071] 10μmol / L reverse primer;
[0072] Sterile double distilled water.
[0073] The working concentration of the fluorescent dye Gelgreen I is 0.5ט1×. The working concentration of the hot start hTaq enzyme is 0.01-0.1 U / μL. The working concentration of the dATP solution, dUTP solution, dGTP solution or dCTP solution is 100-200 μmol / L.
[0074] Prepare the DNA to be tested according to the conventional method, establish the PCR reaction system, and carry out the qPCR reaction.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com