MicroRNA (ribonucleic acid) detection probe and method for detecting microRNA
A technology for detecting probes and probes, which is applied in the fields of molecular biology and nucleic acid chemistry, can solve problems such as large limitations, high price, and limited sensitivity, and achieve the effects of simplified design, strong specificity, and low detection limit
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] 1. Design of microRNAs detection probe system
[0036] (1) if figure 1 As shown, the probe was synthesized from Dalian Bao Biology Co., Ltd., and the probe was aimed at the sequence of miR141, the sequence of which is: UAACACUGUCUGGUAAAGAUGG (SEQ ID No 1). miR141 is an important tumor marker. The probe consists of three parts, the region complementary to the target microRNA, which is responsible for recognizing the corresponding microRNA and forming a DNA-RNA hybrid duplex structure. One end is labeled with biotin, and the probes that do not participate in the reaction are bound to the solid phase by using the streptavidin-biotin system, and the unreacted probes are separated. The other end is connected with DNase as a signal output part. The probe sequence is: biotin-TTTTTTTTTTTT CCATCTTTACCAGACAGTGTTA TGGGTAGGGCGGGTTGGG (SEQ ID No 2).
[0037] (2) The detection goal to be achieved: the corresponding target microRNA probe can produce a good signal response, the fluo...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap