Chitosan nanoparticle, biopesticide preparation for controlling pine wood nematode and preparation method thereof
A technology of chitosan nanoparticles and pine xylophilus, which is applied in botany equipment and methods, biocides, nematicides, etc., can solve the problems of unrealized standardization level, small molecular weight, and difficulty in large-scale production, and achieve high Pest control effect, standardization of production steps, effect of improving stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] The present embodiment particularly provides chitosan with pine wood nematode acetylcholinesterase gene double-stranded ribonucleic acid sequence as active ingredient
[0047]
[0048] Preparation of sugar nanoparticle biological preparation and its effect research.
[0049] (1) Design and synthesis of original drug components targeting pine wood nematode acetylcholinesterase gene double-stranded ribonucleic acid
[0050]
[0051] The 3' end of the above sequence is provided with dTdT dangling bases. The double-stranded ribonucleic acid is designed and synthesized according to the above sequence and freeze-dried into the powder of the original medicine.
[0052] (2) Preparation of 0.05% double-stranded ribonucleic acid biopesticide preparation
[0053] 1 Dissolution of active ingredients: Weigh 500mg of the above-mentioned double-stranded ribonucleic acid, dissolve it in 199.5g of water, stir at 800r / min to fully dissolve;
[0054] 2 Preparation of chitosan nan...
Embodiment 2
[0073] This example particularly provides the preparation and effect research of the chitosan nanoparticle biological preparation targeting the double-stranded ribonucleic acid sequence of the calprotectin gene of pine wood nematode as the active ingredient.
[0074] (1) Design and synthesis of active ingredients for double-stranded RNA of pine wood nematode calreticulin gene
[0075] CRT: GU585910
[0076] Si-CRT_001: GACTGTGGAGGTGGATATTTG
[0077] Sense strand (5'-3'): 5'GACUGUGGAGGUGGAUAUUUGdTdT3'SEQ ID NO.19
[0078] Antisense strand (3'-5'): 3'dTdTdTdTCUGACACCCUCCACCUAUAAAC5'SEQ ID NO.20
[0079]Si-CRT_002: GAGATCTACAAGTTCGATGAC
[0080] Sense strand (5'-3'): 5'GAGAUCUACAAGUUCGAUGACdTdT3'SEQ ID NO.21
[0081] Antisense strand (3'-5'): 3'dTdTCUCUAGAUGUUCAAGCUACUG5'SEQ ID NO.22
[0082] Si-CRT_003: TTGAATTATCTTGGAAATGAC
[0083] Sense strand (5'-3'): 5'UUGAAUUAUCUUGGAAAUGACdTdT3'SEQ ID NO.23
[0084] Antisense strand (3'-5'): 3'dTdTAACUUAAUAGAACCUUUACUG5'SEQ ID NO.24...
Embodiment 3
[0106] This example particularly provides the preparation and effect research of the chitosan nanoparticle biological preparation aimed at the double-stranded ribonucleic acid sequence of the electron transfer flavoprotein gene of pine wood nematode as the active ingredient.
[0107] Electron transfer flavoprotein gene: GU130161
[0108] (1) Design and synthesis of double-stranded ribonucleic acid technical drug for pine xylophilus electron transfer flavoprotein gene
[0109] Si-001: ACGAAATTAGTGTGCTGGTG
[0110] Sense strand (5'-3'): 5'ACGAAAUUAGUGUGCUGGUGdTdT3'SEQ ID NO.25
[0111] Antisense strand (3'-5'): 3'dTdTUGCUUUAAUCACACGACCAC5'SEQ ID NO.26
[0112] Si-002: ATCGTCCCGACCTCCAAACC
[0113] Sense strand (5'-3'): 5'AUCGUCCCGACCUCCAAACCdTdT3'SEQ ID NO.27
[0114] Antisense strand (3'-5'): 3'dTdTUAGCAGGGCUGGAGGUUUGG5'SEQ ID NO.28
[0115] The 3' end of the above sequence is provided with dTdT dangling bases. The double-stranded ribonucleic acid is designed and synthesi...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com