Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene detection kit for Thailand type alpha-thalassemia

A technology for thalassemia and gene detection, which is applied in the field of biomedicine, can solve problems such as time-consuming and laborious, unsuitable for popularization and application, errors and error correction of sequencing platforms, etc., and achieves the effects of convenient use, good social and economic benefits, and high accuracy

Active Publication Date: 2013-02-27
亚能生物技术(深圳)有限公司
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this method has high accuracy, it is cumbersome to operate, time-consuming and labor-intensive, requires a large amount of DNA, requires radioactive labeling, and cannot be applied to the detection of non-deleted genes. Therefore, it is generally only suitable for research use and is not suitable for clinical application.
[0007] (2) Probe Ligation Amplification (MLPA): MLPA was developed in 2002 and is commonly used in the detection of α-thalassemia deletion genes. Hours, and requires special equipment, generally only used for research, not convenient for the popularization and application of molecular screening methods
[0008] (3) Sequencing technology: The direct analysis of DNA sequences by sequencing technology has always been considered as the gold standard for clinical testing; currently, sequencing technology faces the problems of specimen processing (nucleic acid extraction), amplification standardization certification, signal detection, and sequencing platform specificity. The problems of error and error correction, as well as possible problems in bioinformatics, clinical verification procedures and standardization problems have not been effectively solved, so they have not been widely used in clinical practice.
[0018] In the existing patented technology of α-thalassemia detection products, there is no direct detection of Thai-type α-thalassemia (-- Thai ) detection, all only appear based on -- SEA ,-α 3.7 ,-α 4.2 ,-α 2.8 and other detection techniques and methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene detection kit for Thailand type alpha-thalassemia
  • Gene detection kit for Thailand type alpha-thalassemia
  • Gene detection kit for Thailand type alpha-thalassemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1 The composition of the gene detection kit of Thai type α-thalassemia of the present invention

[0040] 1. Primer design and screening:

[0041] Comparative analysis of human α-globin gene sequence, Thai type α-thalassemia (-- Thai ) The upstream of the breakpoint position is 10724-10725 (Genebank No: Z84721), and the downstream is 1219-1220 (Genebank No: Z69706). Primers were designed at the upstream 5' end and downstream 3' end of the breakpoint respectively, THAI-F It binds to the 5' end of the a-globin protein gene cluster, and THAI-R binds to the 3' end of the a-globin protein gene cluster. Utilize orthogonal test and gradient PCR experiment, carry out the screening of primer, screen suitable primer combination, preferred primer combination sequence is as follows:

[0042] THAI-F: AGATCAGTTCCCAGCAAGCCTGGTG;

[0043] THAI-R: GAGATTGCCGATTGTTGAGATTG.

[0044] 2. Optimization of PCR reaction system

[0045] 2 PCR primer storage solution THAI-F and THA...

Embodiment 2

[0061] Embodiment two The detection situation of the kit of the present invention to the clinical sample

[0062] 1. With the results of clinical blood routine and hemoglobin electrophoresis as contrast, 100 samples with abnormal blood routine were detected by using the kit of the present invention. Three cases of Thai type α-thalassemia (-- Thai ) patients, while other genotypes and normal samples were not detected. The detection result of the kit of the present invention is consistent with the results of blood routine and hemoglobin electrophoresis. The screened samples were subjected to gold standard sequencing analysis, and the test results are shown in Table 3: The test results of the kit of the present invention on clinical samples, and the results of statistical analysis and comparison are shown in Table 4: Comparison between the test results of the kit of the present invention and the sequencing results.

[0063] table 3

[0064]

[0065]

[0066]

[0067] ...

Embodiment 3

[0078] Embodiment three The clinical application of kit of the present invention

[0079] 1. Purpose

[0080] For the rare genotype Thai type in α-thalassemia (-- Thai ) to provide a reliable basis for genetic screening of thalassemia. In clinical application, when the patient's clinical manifestations are -- SEA Homozygous, α-thalassemia point mutation (detection of α CS α, α QS α) Not detected, use missing α-thalassemia products on the market (detection-- SEA ,-α 3.7 and-alpha 4.2 ) when doing genetic analysis, only one of the patient's parents carries -- SEA genes, and the other has none-- SEA Gene, can carry Thai type α-thalassemia (-- Thai ) detection. In the second case, the patient has obvious clinical symptoms of standard α-thalassemia, but utilizes the missing α-thalassemia product (test-- SEA ,-α 3.7 and-alpha 4.2 ) detection, missing thalassemia features were not detected, and Thai type α-thalassemia (-- Thai ) detection.

[0081] 2. Inspection princi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of biological medicine, and in particular relates to a gene detection kit for quickly detecting Thailand type alpha-thalassemia in a clinic sample. The technical scheme of the gene detection kit aims at providing the gene detection kit for the Thailand type alpha-thalassemia, wherein the gene detection kit comprises PCR (polymerase chain reaction) liquid, the PCR reaction liquid comprises a forward primer THAI-F and a reverse primer THAI-R, the primers are the forward 10724-10725 position and the reverse 1219-1220 position of the breaking point position aiming at the Thailand type alpha-thalassemia, and the primers are respectively designed at the forward 5'-end and the reverse 3'-end of the breaking point. According to the kit provided by the invention, the leak detection of the alpha-thalassemia caused by the common blood screening method can be reduced, the birth of the children who suffer from the heavy type alpha-thalassemia can be reduced or avoided, and a condition can be created for the more comprehensive thalassemia screening. The detection kit provided by the invention is convenient to use, high in accuracy, and good in social benefit and economic benefit in the high incidence area of the thalassemia.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a kit for rapidly detecting the genotype of Thai-type α-thalassemia in clinical samples. Background technique [0002] α-thalassemia "thalassemia" (abbreviated as α-thalassemia) is an autosomal recessive genetic disease and one of the most common human single-gene genetic diseases in the world. common disease. The disease is caused by the deletion or mutation of the globin gene sequence, which leads to the disorder of the synthesis of the α-globin peptide chain, which reduces or fails the synthesis of the α-globin peptide chain, and makes the synthesis of the α- and β-chains that make up the globin lose. Hemolytic anemia caused by balance. [0003] The human α-globin gene cluster is located on chromosome 16 p13.3, about 40kb in length, each chromosome has 2 α-globin genes, and a pair of chromosomes has 4 α-globin genes; most α-thalassemias are caused by α-globin It is caused by the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 李长远梁少明刘晶晶任维
Owner 亚能生物技术(深圳)有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products