Method for promoting cell to differentiate into female genital cell based on overexpression of Figla gene
A germ cell and gene technology, applied in the field of promoting cell differentiation to female germ cells based on the overexpression of Figla gene, can solve the problems of limited number of differentiation, long induction process, poor induction efficiency and repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0038] The present invention will be further described in detail below in conjunction with specific embodiments, which are explanations of the present invention rather than limitations.
[0039] 1. Cloning and vector construction of Figla gene
[0040] According to the mouse Figla gene sequence (NCBI: NM_012013.1) in the GenBank database, use the Primer Premier 5.0 primer design software to design the upstream and downstream primers for amplifying the Figla gene and mutate the stop codon of the Figla gene, and select appropriate restriction endonucleases. Enzyme, specifically design the following primers:
[0041] Upstream primer: 5′TC AGATCT TGGTCTTGACCACCATGGATA 3′
[0042] Downstream primer: 5′CT GAATTC CATCAGACTCCTCATGAGTGAAGTA 3′
[0043] The underlined part in the upstream primer is the Bgl II restriction site, and the underlined part in the downstream primer is the EcorI restriction site;
[0044] The Figla gene PCR amplification reaction system was 15 μL, which ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap