Method for promoting cell to differentiate into female genital cell based on overexpression of Figla gene

A germ cell and gene technology, applied in the field of promoting cell differentiation to female germ cells based on the overexpression of Figla gene, can solve the problems of limited number of differentiation, long induction process, poor induction efficiency and repeatability

Inactive Publication Date: 2012-07-04
NORTHWEST A & F UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, it has been reported that the number of induced pluripotent stem cells to differentiate into germ cells, especially oocytes, is limited, the induction efficiency and repeatability are poor, the induction process is long, and the effect is unstable. The role and mechanism of cytokines, microenvironment and some key genes in the development and differentiation of stem cells to germ cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for promoting cell to differentiate into female genital cell based on overexpression of Figla gene
  • Method for promoting cell to differentiate into female genital cell based on overexpression of Figla gene
  • Method for promoting cell to differentiate into female genital cell based on overexpression of Figla gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0038] The present invention will be further described in detail below in conjunction with specific embodiments, which are explanations of the present invention rather than limitations.

[0039] 1. Cloning and vector construction of Figla gene

[0040] According to the mouse Figla gene sequence (NCBI: NM_012013.1) in the GenBank database, use the Primer Premier 5.0 primer design software to design the upstream and downstream primers for amplifying the Figla gene and mutate the stop codon of the Figla gene, and select appropriate restriction endonucleases. Enzyme, specifically design the following primers:

[0041] Upstream primer: 5′TC AGATCT TGGTCTTGACCACCATGGATA 3′

[0042] Downstream primer: 5′CT GAATTC CATCAGACTCCTCATGAGTGAAGTA 3′

[0043] The underlined part in the upstream primer is the Bgl II restriction site, and the underlined part in the downstream primer is the EcorI restriction site;

[0044] The Figla gene PCR amplification reaction system was 15 μL, which ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for promoting cells to differentiate into female genital cells based on overexpression of Figla gene. The Figla gene has the nucleotide sequence shown in SEQ ID. NO.1. The Figla gene is labeled and is used for transfecting pluripotent stem cells so as to promote the pluripotent stem cells to differentiate or transdifferentiate into the female genital cells. After pDsRed1-N1-Figla transfercts mESCs (Mouse Embryonic Stem Cells), RFP (Red Fluorescent Protein) is expressed in noble cells at the cell cloning margin and not expressed in the smooth position at the cloning margin; and the transfected mESCs grow in a flake shape after passage, and most of the transfected mESCs do not form cloning, indicating the Figla gene promotes the differentiation of mESCs.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for promoting cell differentiation to female germ cells based on the overexpression of Figla gene. Background technique [0002] The genesis of female germ cells refers to the formation, development and maturation of female gametes, including the migration of primordial germ cells (PGCs), the proliferation of oogonia, the generation of follicles, and the maturation of oocytes. In the ovary, the primordial follicle is the most basic unit of the reproductive system and the basis for the development of dominant follicles. The research results show that many transcription factors that regulate the formation of follicles and embryos start to function from the growth and development of early follicles, so the regulation of early follicles is very important. [0003] Germline a factor (Figla) is the first transcription factor specifically expressed in germ cells, which regulates key...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/12C12N15/63C12N5/10
Inventor 胡玥华进联
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products