Supercharge Your Innovation With Domain-Expert AI Agents!

Method for screening pig disease resistant breeds, and application thereof

An anti-virus, porcine genome technology, applied in the field of molecular genetics, can solve problems such as overinfection, loss of natural immunity of influenza virus, and rapid death

Active Publication Date: 2012-01-04
SHANDONG AGRICULTURAL UNIVERSITY
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Knockout of the Mx1 gene results in complete loss of natural immunity to influenza virus in mice, leading to overinfection and rapid death

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for screening pig disease resistant breeds, and application thereof
  • Method for screening pig disease resistant breeds, and application thereof
  • Method for screening pig disease resistant breeds, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Pig Mx1 Cloning, sequencing and mutation site analysis of the 5′ regulatory region sequence

[0028] Genome extraction: Pig ear tissue was taken, and genomic DNA was extracted according to the instructions of the TIANamp genomic DNA (Tiangen) kit.

[0029] According to NCBI (NCBI Reference Sequence: NC_010455.3), the following primers were designed, Mx1 The AF gene sequence is shown in Seq ID No:3, Mx1 The sequence of the AR gene is shown in Seq ID No:4, which covers the range from 18 bp downstream of the transcription start site to 2453 bp upstream, so as to obtain the full length of the sequence and perform sequence comparison to find differences in regulatory sequences.

[0030] Primer name Primer sequence Primer position Mx1 AF CTCTCCAAATGTCCACGACTTCTT -2453 Mx1 AR CTGTTCTCCCACACTTACTTGAAATCA +18

[0031] Prepare the PCR reaction solution according to the following system

[0032]

[0033] 2 x Prime STAR T...

Embodiment 2

[0064] Example 2 Pig Mx1 Effects of Mutations in the 5′ Regulatory Region on Initiating Activity

[0065] According to the genotyping results, genotype A and genotype B were used as templates, and the amplified products were mixed with 6×Loading buffer and loaded onto 0.5% TAE agarose gel, electrophoresed at 5V / cm for 20min, and then recovered by cutting the gel The 2.5kb fragment was purified according to the purification instructions of the Axygen Agarose Gel Purification Kit. The purified product was connected to the pGL-3 basic vector (Promega), cloned and transformed into DH5α, and a single colony was picked and sequenced. The sequence was correct and obtained Mx1 A promoter Luc and Mx1 B promoter Luc Two promoter reporter gene vectors. Inoculate the bacterial solution containing the correct insert into LB liquid medium containing 100 μg / ml ampicillin at a ratio of 1:500, and incubate vigorously at 200 rpm at 37°C for 14 hours. Collect the bacteria at 6000×g at ...

Embodiment 3

[0070] Example 3 Marker Assisted Breeding

[0071] According to attached figure 2 According to the genotype detection results of pigs, combined with the disease resistance characteristics of various pig species, the inventor detected the length polymorphism of the pig Mx1 5′ regulatory region by PCR, and inserted a 275bp fragment as a disease resistance-related gene marker, which would carry the disease resistance gene Marked pigs are bred, and after the piglets are born, the markers are identified, and pigs with strong disease resistance and excellent growth performance are screened out from them through comprehensive selection, so that excellent disease-resistant pig breeds can be established.

[0072]

[0073]

[0074]

[0075]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular genetics, and specifically relates to a molecular marking method for a pig MX1 gene 5' control region mutable site, and an application thereof in pig disease resistance breeding. According to the invention, a plurality of differences are found in MX1 5' control regions of different breeds of pigs. Among Chinese local pig breeds, a 275bp segment inserted gene is a dominant genotype. Among western pig breeds, the frequency of the genotype is low. With a luciferase reporter assay system, it is found that, the activity of a promoter with an inserted275bp segment is substantially higher than that of another. The existence of the 275bp segment in a pig genome MX1 control region can serve as a molecular mark related to pig disease resistant characters. The method is simple and fast, and is not influenced by the environment. With the method, early-stage breed selection can be realized.

Description

technical field [0001] The invention relates to the field of molecular genetics, in particular to a method for screening pig disease-resistant breeding, by judging pig Mx1 The polymorphism of the mutation site in the 5' regulatory region of the gene is used for selection, and the mutation site is artificially used to achieve excellent breeding. Background technique [0002] Myxovirus resistance protein A (Myxovirus resistance protein 1, Mx1 ) is one of the interferon (IFN)-induced proteins, which have anti-virus activity. Mx1 It is an antiviral protein of 78000 u produced by type I interferon (IFNα / β)-induced cells. It is a new type of antiviral protein discovered after the discovery of 2.5 A oligoadenylate synthase and protease produced by IFN-induced cells. In mammals, members of the Mx family that have antiviral effects are called MxA or Mx1 , distributed in the cytoplasm of cells, this cytoplasmic protein can directly exert antiviral effects on influenza virus and f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 姜运良梁森康丽
Owner SHANDONG AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More