Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mice transplanted with human hepatocytes

A liver cell and mouse technology, applied in the field of mice transplanted with human liver cells, can solve the problems of human liver cell damage and adenovirus without species specificity

Active Publication Date: 2011-12-14
CENT INST FOR EXPERIMENTAL ANIMALS +1
View PDF10 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the adenovirus itself has no species specificity, it is considered that its residual in mice may cause damage to human hepatocytes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mice transplanted with human hepatocytes
  • Mice transplanted with human hepatocytes
  • Mice transplanted with human hepatocytes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0178] Preparation of TK-NOG mice and analysis of their functions

[0179] 1. Method

[0180] This example was carried out by the following method.

[0181] (1) Preparation of transgenic mice

[0182] Such as figure 1As shown, a herpes simplex virus type 1 thymidine kinase (UL23 or HSVtk) gene expression unit was constructed. First, a 42-nucleotide polylinker (GATCCAAGCTTATGCAGTCGACCCGGGCATGCGAATTCTCGA: SEQ ID NO: 2) was introduced into the Bam HI-Xho I site (pBSII / linker) of pBlueScriptII (pBSII; Promega). The HSVtk gene was amplified by PCR at an annealing temperature of 62°C using the following primers.

[0183] HTKF, 5'-GCTAGCATGGCTTCGTACCCCCTGC-3' (SEQ ID NO: 3)

[0184] HTKR, 5'-GTCGACTCAGTTAGCCTCCCCCCATCTC-3' (SEQ ID NO. 4)

[0185] Next, the amplified product was cloned into the Nhe I-Sal I site (pCI-TK) of pCI plasmid (Promega). The 3' flanking region of human growth hormone (hGH) was amplified by PCR using the following primers at an annealing temperature of 6...

Embodiment 2

[0256] Example 2 Preparation of uPA-NOG mice and its functional analysis

[0257] 1. Method

[0258] This example was carried out by the following method.

[0259] (1) Preparation of transgenic mice

[0260] Such as Figure 25 The mouse urokinase-type plasminogen activator factor (Plau or uPA) gene expression unit was constructed as shown. First, the mouse uPA gene was amplified by PCR using the following primers at an annealing temperature of 60°C.

[0261] MuPA-Nhe1-F, 5'-GCTAGCGGCACTACCATGAAAGTC-3' (SEQ ID NO: 48) MuPA-Sal1-R, 5'-AATTAAGTCGACAACAAGTGACCC-3' (SEQ ID NO: 49)

[0262]The herpes simplex virus type 1 thymidine kinase gene expression plasmid (pmAlbEPintUL23GH) described in Example 1 was double-digested with the restriction enzyme Nhe I Sal I to remove the herpes simplex virus type 1 thymidine kinase gene portion, and then, in The above-mentioned mouse uPA gene (SEQ ID NO: 47) treated with the enzyme was cloned at the corresponding site to obtain a plasmid (p...

Embodiment 3

[0292] Example 3 Evaluation of the Dynamics of Drugs in Plasma, Identification of Metabolites, Metabolism Rates, etc.

[0293] 1. Metabolism test of isoquine (DB) or S-warfarin (WF) in mouse organisms with humanized liver

[0294] For chimeric mice (hu-Liver: human albumin concentration in the blood is 4.5 mg / mL or higher) whose liver has been replaced by human hepatocytes for more than 50%, DB (Research Biochemicals International), or WF (Wako Pure Chemical Industries, Ltd.) was intraperitoneally administered at a volume of 30 mg / kg. Blood samples with a volume of 40 μl were recovered by orbital blood sampling 0, 0.5, 1, 2, 4, 7, and 24 hours after administration of DB or WF, and plasma was separated from the blood by centrifugation.

[0295] 2. Quantification of DB, 4-hydroxyl DB (4-OH DB), WF and 7-hydroxyl WF (7-OH WF) by LC-MS / MS

[0296] The concentrations of DB and 4-OH DB in plasma were determined by the following method. 150 μL of distilled water was added to 5 μL ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

Disclosed is a mouse having human hepatocytes transplanted therein. Specifically disclosed is a mouse having human hepatocytes transplanted therein.  In the mouse, a foreign thymidine kinase gene or an urokinase-type plasminogen activator gene is retained so that the gene can be expressed specifically in the liver of the mouse, and hepatocytes of the mouse are substituted by human hepatocytes.

Description

technical field [0001] The present invention relates to a mouse transplanted with human hepatocytes, in which the thymidine kinase gene remains in the liver of the mouse and can be expressed, the mouse is administered with guanosine nucleoside analogues and isolated from human out hepatocytes. Furthermore, the present invention relates to a NOG mouse transplanted with human hepatocytes, in which the urokinase-type plasminogen activator factor gene is maintained in the mouse liver and can be expressed, for The mice were administered hepatocytes isolated from humans. Furthermore, the present invention relates to a method for preparing a mouse transplanted with human hepatocytes, the preparation method comprising the steps of: administering a guanosine analogue to a mouse whose thymidine kinase gene is maintained in the liver of the mouse and can be expressed. and hepatocytes isolated from humans. The present invention also relates to a method for measuring the dynamics of a t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01K67/027C12N7/00C12N15/09C12Q1/02G01N33/15G01N33/50
CPCA01K2227/105C12N9/6459A01K2217/052A01K2207/15A01K67/0271A01K67/0275A01K2267/035C12Y304/21069A01K2217/30A61P1/16A61P31/14A01K67/027A01K2217/072A01K2267/0368C12N7/00G01N33/15
Inventor 末水洋志川井健司中村雅登长谷川雅巳
Owner CENT INST FOR EXPERIMENTAL ANIMALS
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More