Method for expressing and purifying neutral protease (NPR)

A technology of neutral protease and expression method, which is applied in botany equipment and methods, biochemical equipment and methods, hydrolytic enzymes, etc. It can solve the problems of difficult to obtain ideal expression and low protein purity, and achieve high expression and simple purification Effect

Inactive Publication Date: 2011-08-31
BEIJING STRONG BIOTECH
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above method is difficult to obtain ideal expression, and the protein purity obtained is low (about 90%)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing and purifying neutral protease (NPR)
  • Method for expressing and purifying neutral protease (NPR)
  • Method for expressing and purifying neutral protease (NPR)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Construction of recombinant plasmid pET28b-NPR

[0039] 1) Design specific primers to amplify the full-length gene by PCR

[0040]Comprehensively analyze the restriction map of NPR and the sequence characteristics of the multiple cloning site (MCS) of the pET28b vector (Novagen), and then design primers, respectively introduce BglII and XhoI restriction sites in the upstream and downstream, and perform NPR PCR under the following reaction conditions After amplification, a fragment of about 2000bp was obtained, which conformed to the theoretical fragment size and could be used for gene cloning.

[0041] Upstream primer: GAGATCTAAGCTTTTATTAGGAAT

[0042] Downstream primer: G CTCGAG TTTCACCCCTAC

[0043] When doing the PCR reaction, the enzyme used is a high-fidelity DNA polymerase; the final concentration of the primers is 0.5uM; the template is the chemically synthesized NPR whole gene sequence.

[0044] 94°C, 5min, 1 cycle; 94°C, 20s, 54°C, 20S, 72°C, 1min...

Embodiment 2

[0049] Embodiment 2: the expression of fusion protein

[0050] 1) Transform Rosetta (DE3) expression strain (Novagen) and express

[0051] The correct recombinant plasmid pET28b-NPR analyzed by the sequencing results was transformed into a Rosetta (DE3) expression strain, and a single colony was removed. After a small amount of cultivation, it was transferred to 500mL LB medium at an inoculum size of 1% for cultivation and expression. , Take it out after 24 hours, collect and save the supernatant after centrifugation.

[0052] 2) SDS-PAGE detection of expressed protein

[0053] The supernatant was detected by SDS-PAGE, and faint bands could be seen. This was because the volume of the LB supernatant was too large, resulting in too low protein concentration in the sample; the protein in the sample was concentrated by TCA precipitation, and then SDS-PAGE Detection showed obvious protein bands.

Embodiment 3

[0054] Embodiment 3: Purification and identification of NPR protein

[0055] 1) NPR affinity nickel column purification

[0056] Since the inventors retained the His tag at the 3' end of the pET28b vector MCS when constructing the recombinant plasmid and expressed it directly behind the NPR, the expressed NPR can directly use the His tag at the 3' end to pass through the affinity nickel column. Purify it. During purification, equilibrate the nickel column and system with a low concentration (20mM) of imidazole, and use a certain percentage of high concentration (500mM) of imidazole for elution, and collect the breakthrough and each elution peak.

[0057] 2) SDS-PAGE detection of the first collected peak after purification

[0058] After the collected peaks were partly precipitated by TCA, they were detected by SDS-PAGE, and an obvious and single expression band could be seen in the elution peak, about 40KDa, slightly larger than the theoretical (37KDa).

[0059] 3) Western ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for expressing and purifying neutral protease (NPR). Research results find that good expression effect can be obtained by modifying pET series carriers and expressing a full-length gene of neutral protease. Thus, the invention provides a method for expressing the neutral protease, which comprises the following steps of: (1) constructing a recombinant expression plasmid through the full-length gene of the neutral protease and the pET carriers with eliminated T7 promoter activity, and (2) transforming escherichia coli through the recombinant expression plasmid constructed through the step (1) so as to express the neutral protease. According to the method provided by the invention, pure NPR protein can be conveniently and simply obtained, and the purification process of the NPR is simplified.

Description

technical field [0001] The present invention relates to the field of biotechnology. In particular, the present invention relates to the field of expression and purification of proteins. Background technique [0002] HbAlc monitoring is the "gold standard" for diabetes treatment and adjustment of treatment plan, and the enzymatic HbAlc determination kit widely used in biochemical analyzers in the market has been recognized by a large number of customers. Neutral protease (NPR), as one of the most important enzymes in the determination of HbAlc kit, is difficult to source and expensive, and it is expressed by means of genetic engineering, which has broad application prospects and good market value. [0003] There are two main ways to express the NPR of Bacillus thermophiles, one is to use Bacillus subtilis to express it, and the other is to use the promoter of NPR itself to express it in Escherichia coli. [0004] At present, the expression of neutral protease NPR (Thermolys...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/50C12N15/09C12N1/21C12N15/55
Inventor 贾如刘希龚俊
Owner BEIJING STRONG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap