Mulberry silkworm pebrine test kit and using method thereof
A microparticle disease and kit technology, applied in the direction of microbe-based methods, microbe measurement/inspection, biochemical equipment and methods, etc., can solve the problem of silkworm microparticle disease that has not been found yet
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0117] The preparation of embodiment 1 kit
[0118] 1. Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0119] Outer primer F3(1): (SEQ ID NO 1)
[0120] CAGGAGTTGCTTTTGCGA
[0121] Outer primer B3 (1): (SEQ ID NO 2)
[0122] AAACGGATTCAGCAGGTA
[0123] Internal primer FIP (1): (SEQ ID NO 3)
[0124] GAAAGCGCTGCTCAAAGCAGttttTGTGCCATTGAATGTCAGA
[0125] Internal primer BIP (1): (SEQ ID NO 4)
[0126] CTGCGCTACCAGCGTTGTTAttttATATCACCATCGGTGGAAG.
[0127] 2. Purchase DNA polymerase: Bst DNA polymerase is placed in the container;
[0128] 3. Prepare the reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L KCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / L MgSO 4 ·7H 2 0.125 volume % TritonX-100, 1mol / L betaine, each 0.2 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3, place container;
[0129] 4. Prepare the sample pretreatment solution: the sample...
Embodiment 2
[0149] The preparation of embodiment 2 kit
[0150] 1. Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0151] Outer primer F3 (2): (SEQ ID NO 5)
[0152] CTTTGAGCAGCGCTTTCA
[0153] Outer primer B3 (2): (SEQ ID NO 6)
[0154] GGGTAAATCTGTTAATGGTTCTT
[0155] Internal primer FIP (2): (SEQ ID NO 7)
[0156] GCATACGTAGACGATGCAGGCttttCAGCTTTAGCTGCGCTAC
[0157] Internal primer BIP (2): (SEQ ID NO 8)
[0158] GGCTTCCACCGATGGTGATAttttACACCACAAAAGATGGTACTG.
[0159] 2. Purchase DNA polymerase: Bst DNA polymerase is placed in the container;
[0160] 3. Prepare the reaction solution and primers: the reaction solution contains 1.6mmol / LdNTP, 20mmol / L Tris-Cl, 10mmol / L KCl, 10mmol / L (NH 4 ) 2 SO 4 , 8mmol / L MgSO 4 , 0.1% by volume TritonX-100, 0.8mol / L betaine, each 0.25 μmol / L of inner primer FIP / BIP and each 1.2 μmol / L of outer primer F3 / B3 are placed in the container;
[0161] 4. Prepare the sample pretreatment solutio...
Embodiment 3
[0176] Example 3 Silkworm microparticle disease ( Nb ) Application of test kit
[0177] 1.1 Materials
[0178] 1.1.1 Spores
[0179] There are 3 spores used in this study, mainly from South China Agricultural University and Guangdong Provincial Sericulture Technology Promotion Center. See Table 1 for details.
[0180] Table 1 Names and sources of spores
[0181] source of spores
Spore and number
South China Agricultural University
Microspores of Bombyx mori Nb
Production sampling samples
Production inspection sample JC1 from Guangdong Provincial Sericulture Technology Extension Center
[0182] other spores
Microspores of Tussah moth from South China Agricultural University
[0183] 1.1.2 Main instruments and reagents
[0184] 1.2 Identification of isolated spores
[0185] Isolation and identification of clinically isolated spores Extract and number the dried female moths as required. According to each box of...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com