Vibrio anguillarum and edwardsiella tarda-resistant multi-valence live vaccine, correlative expression vector and application
An expression vector, the technology of Vibrio anguillarum, applied in the fields of application, antibody medical ingredients, medical preparations containing active ingredients, etc., can solve problems that have not yet been seen, and achieve a unique and ingenious design, easy immune response, and good immune protection effect Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The construction of embodiment 1 recombinant expression vector
[0039] 1.1 Primer design
[0040] Primers gapA-Lo-F (sequence shown in SEQ ID NO: 3), gapA-Lo-R (sequence shown in SEQ ID NO: 4) were designed according to the sequence (gapA40) shown in SEQ ID NO: 1; gapA-N-F ( sequence shown in SEQ ID NO: 5), gapA-N-R (sequence shown in SEQ ID NO: 4); gapA-F (sequence shown in SEQ ID NO: 6), gapA-R (sequence shown in SEQ ID NO: 7 ); N-F (sequence shown in SEQ ID NO: 10) and N-R (sequence shown in SEQ ID NO: 11) were designed according to the sequence shown in SEQ ID NO: 8, and the sequences of the above primers and the enzyme cleavage sites therein are as follows:
[0041] gapA-Lo-F: CCG GAATTC ATGACTATCAAAGTA (EcoRI restriction site)
[0042] gapA-Lo-R:CCA CTGCAG TTACTTAGAGATGTGTGCGA (P stI restriction site)
[0043] gapA-N-F: CGC GGATCC ATGACTATCAAAGTAGGTAT (BamHI restriction site)
[0044] gapA-N-R: Same as gapA-Lo-R
[0045] gapA-F: TAGGA GAATTC GATGACTA...
Embodiment 2
[0064] Example 2 Construction of Vibrio anguillaris Recombinant Strain
[0065] Vibrio anguillarum MVAV6203 (from the China Center for Type Culture Collection, the preservation number is: CCTCC NO: M 204066, the preservation date is September 7, 2004, please refer to Chinese patent ZL200410089496.0 for details, and the application date is December 2004 14) inoculated in 30ml of high-salt LB culture solution (in order to add NaCl to the LB medium to a final concentration of 2.5%), shake and cultivate overnight at 30°C, and then transfer to 1:100 (v / v) Inoculate in 100ml of fresh high-salt LB culture medium, shake and culture at 200rpm at 30°C until the OD600 value is 0.4-0.6, collect the bacteria by centrifugation, place the bacteria in an ice bath for 20-30min, and use 272mM sucrose Wash the cells with the buffer solution for 3 times, and then suspend the cells with sucrose buffer solution to make the final concentration of the cells reach 1*109cfu / ml or more, and obtain elect...
Embodiment 3
[0070] Embodiment 3 multi-potency attenuated live vaccine screening
[0071] The recombinant bacterial strains VA (pG40), VA (pNG40), VA (Plorf1G40), VA (PluG40), VA (Pworf1G40) and VA (PwuG40) obtained in the steps of Example 2 were respectively inoculated in the culture medium containing 200 μg / ml ampicillin In LB high-salt liquid medium, 200rpm, 30°C cultured overnight, inoculated in 100ml LB high-salt (Amp) medium the next day at 1:100 (v / v), cultured at 30°C, 200rpm for 20h, and harvested the culture solution.
[0072] After the bacterial pellet was washed 3 times with PBS (PH=7.4), resuspended with 1ml PBS, and set to OD with Nano Drop nucleic acid quantifier 600 =1, sonicate in an ice bath for 5 minutes until the cells are completely broken, and centrifuge the obtained lysate at 4°C and 8000g for 2 minutes to obtain the whole bacterial fraction. The whole bacterial components were tested by ELISA, and the results were as follows: image 3 shown.
[0073] image 3 It...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com