Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Improved floral-dip method for transforming maize in permeable medium

A flower soaking method and culture medium technology, applied in the field mediated by Agrobacterium, can solve problems such as unreported grass crops

Active Publication Date: 2014-02-12
BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the method of dipping flowers has been applied to the Brassica crops of dicotyledonous plants Brassicaceae and has been successfully transformed, but there is no report on the transformation of gramineous crops using the dipping method.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improved floral-dip method for transforming maize in permeable medium
  • Improved floral-dip method for transforming maize in permeable medium
  • Improved floral-dip method for transforming maize in permeable medium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Embodiment 1, soaking flower method to transform and obtain corn transgenic plant

[0018] 1. Transformation of maize plants by soaking flowers

[0019] 1. Experimental materials

[0020] Agrobacterium strain: the Agrobacterium strain is Agl0, which is preserved in this laboratory. Contains plasmid vector KAT-A1.

[0021] Plasmid: KAT-A1 contains the red fluorescent protein reporter gene AsRed from jellyfish, with the hpt selection marker gene, which can resist Hygmycin antibiotics. The KAT-A1 vector was constructed in our laboratory. (Such as figure 1 )

[0022] Maize varieties for transformation: varieties cultivated by our company: K12, K36.

[0023] 2. Cultivation of Agrobacterium tumefaciens

[0024] Pick the Agrobacterium containing the target gene frozen in glycerol, draw a line on the YEB+Amp+Rif plate, and culture in the dark at 28° for 2 days. Pick a single colony and inoculate it in 50ml of resistant YEB liquid medium, shake overnight at 28°200rpm. P...

Embodiment 2

[0037] Example 2, Screening and detection of T1 generation transformants

[0038] 1. Antibiotic screening of T1 generation transformants

[0039] The harvested T1 generation seeds were screened with Hygmycin. The transformant was insensitive to Hygmycin because of the hpt resistance gene. The screening concentration of Hygmycin was 20mg / L, and the resistant plants were selected two weeks later for further molecular detection and verification.

[0040] 2. PCR detection of T1 generation transformants

[0041] For the plants showing resistance to Hygmycin, the hpt gene was detected by PCR. Plant genomic DNA was extracted using the CTAB method. According to the sequence of the hpt gene, the PCR amplification primer sequences were designed as follows:

[0042] Primer 1 (upstream primer): 5' TCGGCGAGTACTTCTACACAGC 3'

[0043]Primer 2 (downstream primer): 5'CTGGCAAACTGTGATGGACGAC 3'

[0044] Use primer 1 and primer 2 to amplify the hpt gene with the genomic DNA template of the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an improved floral-dip method for transforming maize, which is characterized in that: surfactants of a permeable medium are Kinetic and Induce, a permeation regulator is mannitol, and antioxidants of DTT and L-Cysteine and antibiotics are added. The floral-dip method for transforming the maize has the characteristics of simplicity, convenience, high efficiency, low cost and the like.

Description

technical field [0001] The invention relates to an agrobacterium-mediated method and application for transforming maize by using an improved infiltration medium and flower soaking method. Background technique [0002] It works a lot. In addition, feed consumption is also the most important consumption channel of corn, accounting for about 70% of the total consumption. The use as industrial raw material is also the main channel of corn consumption. There are many products that can be developed from corn, and it is the most widely used industrial raw material among food crops. Corn is widely used in the production of starch, paper, food, textiles, medicine and other industries. Alcohol produced from cornstarch is a clean "green" fuel that may replace traditional fuels and be widely used in the 21st century. [0003] Maize is suitable for planting in dry land. It has a large sown area in China and is widely distributed. It is one of the main grains for people in northern an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/87
Inventor 张会新何峰夏勉
Owner BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com