Plant promoter related to photoperiod and application thereof

A promoter and photoperiod technology, applied in the fields of application, plant products, botanical equipment and methods, etc., can solve the problems that hinder the adaptability of soybean varieties, achieve the effects of reducing metabolic burden, increasing crop yield, and improving adaptability

Inactive Publication Date: 2010-09-15
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This characteristic seriously hinders the adaptability of soybean varieties and is a key factor restricting the increase and stability of soybean yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant promoter related to photoperiod and application thereof
  • Plant promoter related to photoperiod and application thereof
  • Plant promoter related to photoperiod and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, the acquisition of promoter GmRAV sequence

[0042] 1. Extraction of total plant DNA

[0043] Soybean (Glycine max (L.) Merri ll.) late-maturing variety Dongnong L13, with unlimited pod formation habit, was cultivated in a light incubator at 25°C with 250 μmol m -2 sec -1 White light, grow under long daylight (LD) (16h / 8h light / dark) conditions, cut the third three-out compound leaf, and extract soybean total DNA according to the CTAB method;

[0044] 2. Primer design: Design primers downstream of the 5' flanking sequence. The specific primer sequences are shown in Table 1.

[0045] Table 1. Primer sequences and degenerate primers at different positions

[0046] Primer position (from ATG) and name

Primer sequence (5'→3')

G1:448

GGCGGCTTCGTCTTCCTCGTT

G3:153

TGTGAAGTGAGTGCAGATAAGGGT

G4:62

GGAAGAAACAGAGAGAAACTTGAGAA

degenerate primer

CAWCGICNGAIASGAA

[0047] 3. The process of Tail-PCR re...

Embodiment 2

[0055] Embodiment 2, the function of promoter

[0056] The GUS gene is the trans-β-glucuronidase gene.

[0057] Genetic resource name: seeds of soybean (Glycine max (L.) Merrill.) variety Dongnong L13. Ways to obtain genetic resources: I. Genetic resources are obtained from: plants, II. Acquisition methods: gift (purchase / gift or exchange / preservation institution / seed bank (germplasm bank) / gene library / self-collection / commissioned collection / others) . Direct source: Obtained in October 2006; non-acquisition method, provider’s name or name: Soybean Science Research Institute of Northeast Agricultural University, provider’s country or region: Heilongjiang Province, China, provider’s contact information 0451-55190484, Harbin, China 59 Timber Street, City. The original source is unclear.

[0058] Seeds of soybean (Glycine max (L.) Merrill.) variety Dongnong L13 (Lin Zhao, Qiulan Luo, Chunli yang Yang, Yingpeng Han, Wenbin Li (2008) A RAV-like transcription factor controls phot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a plant promoter related to a photoperiod and an application thereof. The promoter is a DNA molecule of which the nucleotide sequence is as shown in (1), (2), (3) or (4) below: (1) a DNA molecule as shown by nucleotides 1-920 from terminal 5' in sequence 1 of a sequence table; and (2) a DNA molecule of which the nucleotide sequence is one in sequence 1 of the sequence table and contains the following sequence: nucleotides 776-920 from terminal 5' in sequence 1 of the sequence table. The promoter can regulate the photoperiod of the plant, can enable genes not to be expressed in soybean seed coats and mature seeds, and can enable genes to be expressed in vascular bundle tissues. The use of the promoter for genetic breeding can effectively improve the photoperiod and the adaptivity of the plant, and enables the plant to grow in the broader environment; and the promoter is especially applicable to crops, enables the crops to be planted in the broader environment and condition, and improves the variety of crops to raise crop yield. Therefore, the promoter has broad application prospects in the aspect of genetic breeding.

Description

technical field [0001] The invention relates to a plant photoperiod related promoter and its application. Background technique [0002] Soybean is a short-day plant sensitive to photoperiod response, and its flowering time is an important agricultural quantitative genetic trait, which was used as an important model plant in the early study of photoperiod response. The growth and development of most soybean plants are sensitive to photoperiod effects, short-days promote flowering, whereas long-days delay and inhibit flower bud growth. This characteristic seriously hinders the adaptability of soybean varieties, and is a key factor restricting the increase and stability of soybean yield. Soybean varieties have a narrow range of adaptation, so many varieties with different photoperiod responses are required to adapt to various ecological conditions. In order to reduce the photosensitivity of soybean varieties, expand the planting area of ​​soybean varieties, and relieve the pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/11C12N15/63C12N15/82C12N1/15C12N1/19C12N1/21C12N5/10A01H5/00
Inventor 李文滨郝迪萩赵琳韩英鹏
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products