Trypanosoma brucei phenylalanyl-tRNA synthetase preparation method
A technology of trypanosoma brucei and phenylalanyl is applied in the field of preparation of trypanosoma brucei phenylalanyl tRNA synthetase, and can solve the problem of low expression efficiency and expression purification of trypanosoma brucei phenylalanyl tRNA synthetase The steps are cumbersome and other problems, and the steps are simple and the purification effect is good.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0034] Step 1, obtaining the α subunit and β subunit genes of Trypanosoma brucei PheRS
[0035] 1. Acquisition of the α subunit gene of PheRS
[0036] (1) Take 20 μg of whole genome DNA of Trypanosoma brucei as a template, amplify the target gene fragment by PCR method, and the upstream and downstream primers used for amplification are primers purified by PAGE, wherein,
[0037] Upstream (Primer F): 5'ATGAGTACCATGGAGAACACCATTCT,
[0038] Downstream (Primer R): 5'AAAACGCATTAGCTTTGAGTTCC;
[0039] (See SEQ ID NO: 1 for the upstream sequence, and SEQ ID NO: 2 for the downstream sequence).
[0040] (2) PCR reaction was carried out with Pfu polymerase, in which the template was genomic DNA, the primers used were Primer F and Primer R, pre-denatured at 98°C for 2 min, denatured at 95°C for 1 min, annealed at 55°C for 1 min, and extended at 68°C for 3 min. 35 cycles, and finally extended at 72°C for 10 min; add 5× loading buffer to the PCR-amplified product, and use 1% agarose gel...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com