Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Special amplimer for detecting tibetan sheep foot rot resistance allele, detecting agent case and method thereof

A technology of alleles and amplification primers, applied in biochemical equipment and methods, measurement/testing of microorganisms, DNA/RNA fragments, etc., can solve problems such as difficult-to-control diseases and drug residues, and achieve high sensitivity and low cost low effect

Inactive Publication Date: 2009-09-16
GANSU AGRI UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, domestic sheep foot rot disease is mainly controlled by drugs, which is difficult to control the disease and there is a risk of drug residues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Special amplimer for detecting tibetan sheep foot rot resistance allele, detecting agent case and method thereof
  • Special amplimer for detecting tibetan sheep foot rot resistance allele, detecting agent case and method thereof
  • Special amplimer for detecting tibetan sheep foot rot resistance allele, detecting agent case and method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] experiment material

[0057] 104 Tibetan sheep were selected from Dashui Breeding Farm in Gannan Tibetan Autonomous Prefecture, Gansu Province, 791 herdsmen's sheep in Luqu County, Gannan Prefecture (223 with foot rot disease), and 72 herdsmen's sheep in Hali Village, Hali Township, Haiyan County, Qinghai Province (22 rats suffering from foot rot), 10 ml of blood was collected from the jugular vein, anticoagulated with ACD, and stored at -20°C. Genomic DNA was extracted from frozen blood samples by phenol-chloroform extraction, dissolved in TE, and stored at 4°C.

[0058] experiment method

[0059] 1. Primer Design and PCR Amplification

[0060] Gene amplification was performed by nested PCR. The size of the amplification product of DQA2-up and DQA2-dn is 828bp, the size of the amplification product of DQA2s-up and DQA2s-dn using the amplification product of DQA2-up and DQA2-dn as a template is 242bp, and the primer sequence is:

[0061] Upstream primer 24bp: DQA2-u...

Embodiment 2

[0081] Embodiment 2: the detection method for the detection of Tibetan sheep foot rot resistance alleles is that the determination steps of Tibetan sheep susceptibility alleles and stronger alleles of resistance are:

[0082] (1) Collect the genomic DNA of Tibetan sheep with normal phenotype and foot rot disease;

[0083] (2) using the above-mentioned specific primers DQA2-up and DQA2-dn to amplify the DNA-specific fragment in step (1);

[0084] (3) using the above-mentioned specific primers DQA2s-up and DQA2s-dn to amplify the PCR product in step (2);

[0085] (4) carry out SSCP detection with the PCR product in step (3);

[0086] (5) each allelic sequence produced in step (4) of cloning and sequencing;

[0087] (6) According to the genotype discrimination result of (4), combined with the phenotype observation data, determine the susceptibility allele and resistance allele of Tibetan sheep foot rot;

[0088] (7) The susceptibility allele for foot rot in Tibetan sheep was d...

Embodiment 3

[0089] Embodiment 3: The detection method for detecting Tibetan sheep foot rot resistance alleles, the specific detection steps are as follows:

[0090] (1) Sample collection: Collect Tibetan sheep with normal phenotype and those suffering from rot, 10ml of jugular vein blood, ACD anticoagulant, and cryopreservation at -20°C;

[0091] (2) Genomic DNA extraction: Genomic DNA was extracted from frozen blood samples by conventional phenol-chloroform extraction;

[0092] (3) Polymerase chain reaction:

[0093] For a 20μL reaction system, the dosage and concentration of the components are: 0.5μL / 10pmol for each of the four primers, 1.2μL / 2.5mm for dNTP, 0.2μL / 2.5U / μL for Taq DNA polymerase, and 2.0μL for 10×buffer containing Mg 2+ 15μM, template DNA 1μL / 50ng, double pure water 14.6μL;

[0094] The first set of primers for the first time: PCR reaction conditions: pre-denaturation at 94°C for 2min, denaturation at 94°C for 30s, annealing at 64°C for 30s, extension at 72°C for 50s,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention mainly relates to a sheep molecular marker assistant breeding technique in the animal biotechnology, in particularly detecting tibetan sheep foot rot resistance allele. The invention provides a special amplimer for detecting tibetan sheep foot rot resistance allele which has characteristic that a first group amplimer has upstream length with 24bp ribonucleotide and downstream length with 22bp ribonucleotide, a second group amplimer has upstream length with 23bp ribonucleotide and downstream length with 24bp ribonucleotide, the upsteam amplimer 24bp: DQA2-up: CACATGTTACAGTGCAAAARCAGC; the downstream amplimer 22bp: DQA2-dn: CCCTCYCACCAACGTTTCCCAG; the upstream amplimer 23bp: DQA2s-up: ACTACCAATCTCATGGTCCCTCT; the downstream amlimer 24bp: DQA2S-dn: GGAGTAGAATGGTGGACACTTACC. The amplimwe has advantages of rapid, high sensitivity and low cost to molecular marker breed selection of the tibetan sheep foot rot.

Description

Technical field: [0001] The invention mainly relates to the sheep molecular marker assisted breeding technology in the field of animal biotechnology, and in particular relates to the detection of Tibetan sheep foot rot resistance alleles. Background technique: [0002] Sheep foot rot is a highly contagious infectious disease caused by Bacteroides nodosa, characterized by inflammation and necrosis of local hoof tissues. After the sheep are ill, they will grow poorly, lose fat, and the quality of wool will decline. If the disease is serious and cannot be treated in time, the sheep will die. Tibetan sheep are prone to foot rot, which breaks out in the rainy season from July to September every year. For example, the incidence of Tibetan sheep in Gansu and Qinghai is as high as 30%, and the mortality rate can reach as high as 10%, which seriously affects the development of sheep breeding in pastoral areas. . [0003] The major histocompatibility complex (MHC) in animals is clos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 罗玉柱胡江刘秀王继卿马小军
Owner GANSU AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More