Yak meat tenderness candidate gene detection kit and detection method thereof

A technology for detection kits and candidate genes, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of low cost and high sensitivity, and achieve low cost, high sensitivity, high specific effect

Inactive Publication Date: 2015-08-26
GANSU AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Molecular selection technology for yak meat tenderness candidate genes to solve the problem of fast, high sensitivity and low cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yak meat tenderness candidate gene detection kit and detection method thereof
  • Yak meat tenderness candidate gene detection kit and detection method thereof
  • Yak meat tenderness candidate gene detection kit and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1: a kind of PCR-SSCP detection primer of tenderness candidate gene of yak meat, its main feature is to include:

[0044] The primer sequences are:

[0045] CAPN3-F: 5'CAGAGTCTCCAGGACACTCACACA3';

[0046] CAPN3-R: 5'CCTTAGAAGGCAGCTCTGAAATTGTG3'.

Embodiment 2

[0047] Embodiment 2: a kind of PCR-SSCP detection kit of tenderness candidate gene of yak meat, its main feature is to comprise PCR reaction liquid, the DNA standard sample of CAPN3*B and CAPN3*C; Deionized water, 10% persulfuric acid Ammonium, loading denaturing buffer, TEMED, 12% non-denaturing polyacrylamide gel Arc:Bis=37.5:1;

[0048] The loading denaturing buffer includes 98% deionized formamide, 0.025% bromophenol blue, 0.025% xylene cyanol, 10mmol / L EDTA pH8.0;

[0049] The PCR reaction solution: a total volume of 20 μL, of which 10×buffer buffer is 2.0 μL, Mg 2+ The concentration is 2.5mM, the final concentration of dNTPs is 100μM, the primers CAPN3-F: 5'CAGAGTCTCCAGGACACTCACACA3' and CAPN3-R: 5'CCTTAGAAGGCAGCTCTGAAATTGTG3' are each 0.1μM, Taq polymerase 0.5U, ddH 2 O make up the volume to 20 μL.

[0050] The nucleotide sequence of the DNA standard sample of CAPN3*B is:

[0051]

[0052] The nucleotide sequence of the DNA standard sample of CAPN3*C is:

[0053]...

Embodiment 3

[0054] Embodiment 3: the using method of described yak meat tenderness candidate gene PCR-SSCP detection kit, its steps are:

[0055] (1) 1μL / 50ng of yak genomic DNA to be tested was mixed with the PCR amplification solution in the kit. The reaction conditions were: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30s, annealing at 62°C for 30s, extension at 72°C for 30s, a total of 35 cycles, and finally Extend at 72°C for 10 minutes to amplify;

[0056] (2) Use the PCR product amplified in step (1) and the DNA standard sample of CAPN3*B or CAPN3*C to mix with the components of the SSCP detection reagent in the kit for SSCP detection;

[0057] (3) The samples whose band pattern detected in step (2) was consistent with the standard transect pattern of CAPN3*B or CAPN3*C were individuals carrying the control allele for tenderness of yak meat.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a yak molecular marker-assisted breeding technology in the technical field of animal biology and specifically relates to a yak meat tenderness candidate gene detection kit. The yak meat tenderness candidate gene PCR (polymerase chain reaction)-SSCP (single-strand conformation polymorphism) detection kit is characterized by comprising a PCR solution, DNA (deoxyribonucleic acid) standard samples of CAPN3*B and CAPN3*C, an SSCP detection reagent, deionized water, 10% of ammonium persulfate, a loading denaturation buffer solution, TEMED (N, N, N', N'-tetramethylethylenediamine) and 12% of non-denatured polyacrylamide gel, wherein Arc: Bis in the non-denatured polyacrylamide gel is 37.5: 1; the loading denaturation buffer solution comprises 98% of deionized formamide, 0.025% of bromophenol blue, 0.025% of xylene cyanol FF and 10mmol / L of EDTA (ethylenediamine tetraacetic acid) with pH value of 8.0. The yak meat tenderness candidate gene detection kit provided by the invention has the characteristics of high speed in molecular marker breeding of yak, high sensitivity, low cost and the like.

Description

technical field [0001] The invention relates to yak molecular marker assisted breeding technology in the field of animal biotechnology, in particular to a yak meat tenderness candidate gene allele detection kit and a detection method thereof. Background technique [0002] Calpain (CAPN) is a class of calcium-dependent cysteine ​​neutral proteolytic enzymes present in the cytoplasm of vertebrates, which is dependent on calpastatin (CAST) and calpain activator The proteolytic enzyme system based on calcium ion plays an important role in the maturation and tenderization of animal muscles after slaughter. Mammals have discovered 16 kinds of calpains, among which CAPN1, 2, 4, 5, 7, 10, 13, 14, 15 and 16 are widely expressed in animal tissues, while CAPN3, 6, 8, 9, 11 and 12 are specific calpain. [0003] The CAPN3 gene of common cattle is located on chromosome 10. There is a certain difference in the correlation between the SNPs of the CAPN3 gene of zebu and common cattle and t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/6888C12Q2600/156C12Q2565/131
Inventor 胡江罗玉柱刘秀李少斌潘红梅
Owner GANSU AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products