Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Avian origin promoter expression vector, construction method and use thereof

The technology of a vector and an expression cassette, which is applied to the avian-derived promoter expression vector and its construction and application fields, can solve the problems of cumbersome steps, low connection efficiency and high cost, and achieve the effect of simple process and ideal efficiency.

Inactive Publication Date: 2009-07-15
CHINA AGRI UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional enzyme-cut ligation method has problems such as cumbersome steps, high cost, and low ligation efficiency.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Avian origin promoter expression vector, construction method and use thereof
  • Avian origin promoter expression vector, construction method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1, construction of pAPP-Vector

[0026] 1) Construction of pA

[0027] Design primers pA Vector1 upstream and pA Vector1 downstream, pA Vector2 upstream and pA Vector2 downstream, the sequences of primers pA Vector1 upstream and pA Vector1 downstream, pA Vector2 upstream and pA Vector2 downstream are as follows:

[0028] Upstream of pA Vector1: 5'ACATGTTCTTTCCTGCGCCGCTACAGGG 3';

[0029] Downstream of pA Vector1: 5'GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3'.

[0030] Upstream of pA Vector2: 5'CTCGAGGATATCTGCA GATATC CAGCACAC 3' (the underlined part is the EcoR V enzyme recognition site);

[0031] Downstream of pA Vector2: 5' CCCTGTAGCGGCGCAGGAAAGAACATGT 3'.

[0032] Using the pEGFP-N1 (Invitrogen) plasmid as a template, use primers pA Vector1 upstream and pA Vector1 downstream to PCR amplify fragment A; use pCDNA3.0 plasmid as a template, use primers pA Vector2 upstream and pA Vector2 downstream to PCR amplify fragment B.

[0033] PCR reaction system: 5 μL of ...

Embodiment 2

[0060] Example 2, the ability of pAPP-vector to express protein

[0061] 1) Construction of pAPP-EGFP-Vector expressing green fluorescent protein

[0062] Design primers EGFP upstream and EGFP downstream, the primer sequences are as follows:

[0063] EGFP upstream: GGAATTCTGCAGATTCGCCACCATGGTGAG;

[0064] Downstream of EGFP: ATGCATGCTCGAGGATTTACTTGTACAGCTCG.

[0065] The GGAATTCTGCAGAT and ATGCATGCTCGAGGAT sequences in the primers are sequences capable of homologous recombination with the nucleotide sequence at positions 695-710 at the 5' end of sequence 1 and the nucleotide sequence at positions 711-726 at the 5' end of sequence 1 .

[0066] Using pEGFP-N1 as a template, the EGFP gene fragment was amplified by PCR with primers EGFP upstream and EGFP downstream.

[0067] Reaction system: 5 μL of 10×PCR Buffer, 1 μL of upstream and downstream primers, 1 μL of DNA template, MgCl 2 (25mM) 3μL, dNTPs (2.5mM each) 3μL, Pfu-Taq (5U / μL) 0.5μL, and finally add water to 50μL.

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an expression vector for an avian promoter and a construction method and an application thereof. The expression vector of the avian promoter is a ring-shaped vector, comprising a procaryon replication origin, a eucaryon replication origin, screening marker genes and a foreign gene expression box; wherein, the foreign gene expression box, from the upstream to the downstream, contains an LTR promoter, a junction fragment and polyadenylic acid tailing signals; the nucleotide sequence of the LTR promoter is the 1st to the 607th position counted from the end of 5' in a sequence 1 in a sequence table; the junction fragment contains EcoRV recognition sequence. With the pAPP-Vector of the invention adopted, the process to construct and express the recombinant vectors of the foreign genes is simple and convenient, rapid, economical and highly efficient; in addition, construction of the expression vectors of a large number of the foreign genes can be accomplished very rapidly; moreover, the pAPP-Vector of the invention can play an important role in studies on transgenic animals.

Description

technical field [0001] The invention relates to an expression vector of an avian origin promoter and its construction method and application. Background technique [0002] Eukaryotic expression vectors are one of the most commonly used expression vectors in molecular biology research. Currently, the most commonly used protein expression vectors are mammalian-derived promoters, which can efficiently express proteins in mammalian cells. my country is a big country in the poultry industry, and the development of the poultry industry has also promoted research in the fields of poultry production, disease prevention and control, especially disease-resistant breeding has gradually been put on the agenda. Due to the lack of protein expression vectors with avian-derived promoters, it is difficult to efficiently express foreign genes in birds or cells. Moreover, the process of constructing a vector expressing a foreign gene from a eukaryotic expression protein vector currently used...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/63C12N15/66C12P21/00
Inventor 刘金华马婧姣刘芹防蒲娟毕玉海傅光华
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com