Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene chip for detecting horse infective virus, preparation, detecting method and reagent kit

A gene chip and virus genome technology, which is applied in the field of gene chips and detection kits for detecting horse-infected virus pathogens, can solve problems such as inadaptability, cumbersome microbial culture technology, and improper control of reaction conditions

Inactive Publication Date: 2009-01-21
IPE BIOTECHNOLOGY CO LTD
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Conventional equine infectious virus detection techniques include microbial culture technology, immune technology, PCR technology, etc. These technologies have the following defects: microbial culture technology is cumbersome and time-consuming; immune technology requires specific antiserum; the superiority of PCR technology itself There is nothing wrong with it, but improper control of reaction conditions can easily cause cross-contamination and false positives
With the increasing frequency of international animal trade and international exchanges of horse racing, conventional detection methods are increasingly unsuitable for large-scale entry-exit animal quarantine requirements, and there is an urgent need for reliable, rapid, and high-throughput new technologies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene chip for detecting horse infective virus, preparation, detecting method and reagent kit
  • Gene chip for detecting horse infective virus, preparation, detecting method and reagent kit
  • Gene chip for detecting horse infective virus, preparation, detecting method and reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0154] Rabies virus DEFINITION Rabies virus isolate Jiangsu_Wx0(H)nucleoprotein(N)gene, complete cds. Design and synthesis of detection probe

[0155] 1. Design

[0156] The detection probe of the virus pathogen was obtained through literature search and comparison of the National Center for Biological Information (NCBI) of the United States.

[0157] In the first step, the target gene of the pathogen was determined based on a large amount of previous literature research. After Genbank search, BLAST sequence alignment obtained a relatively conserved region (target sequence);

[0158] In the second step, according to the principle of probe design, use Primer Premier5.0 and Oligo6.0 software to design detection probes for pathogens in this conserved region;

[0159] After obtaining the sequence of the detection probe, a specialized biological company will synthesize the corresponding probe fragment. The corresponding nucleic acid sequence is as follows:

[0160] The followin...

Embodiment 2

[0172] Equine infectious arteritis virus (Equine arteritis virus) DEFINITION Equine arteritisvirus isolate DK-lab GL protein mRNA, complete cds. The design and synthesis method of the probe are the same as in Example 1, the relative sequence of the equine infectious arteritis virus genome nucleic acid sequence selected The conserved region (target sequence) is:

[0173] Fragment 2 (SEQ ID NO: 2)

[0174] TTCACAGACTTCACCTTGTGTATGCTGACGGATCGCGGCGTTATTGCCAATTTGCTGCGATATGATGAGCACACTGC

[0175] TTTGTACAATTGTTCCGCCAGTAAAACCTGTTGGTATTGCACATTCCTGGACGAACAGATTATCACGTTTGGAACCG

[0176] ATTGTGATGACACCTACGCGGTCCCAGTTGCTGAGGTCCTGGAACAGGCGCATGGACCGTACAGTGCGCTGTTTGAT

[0177] GACATGCCCCCTTTTTATTACTATGGCCGTGAATTCGGCATAGTTGTGTTGGATGTGTTTATGTTTCTATCCCG

[0178] The selected detection probe is: TGCACATTCCTGGACGAACAGATTATCACGTTTGGAACCGATTGTGATGACACC (SEQ ID NO: 6)

Embodiment 3

[0180] Equine infectious rhinopneumonia virus (Equine herpesvirus 1) DEFINITION Equine herpesvirus 1strain V592, complete genome. The design and synthesis method of the probe are the same as in Example 1, and the relatively conserved region (target sequence) of the equine infectious rhinopneumonia virus genome nucleic acid sequence selected )for:

[0181] Fragment 3 (SEQ ID NO: 3)

[0182] GCCGCCTTTGAGATTGACATCCTACTGCCCAGTGACCTATCTCCCGCTGACCTGTCAGCTCTTCAAAAATGCGAGGG

[0183] TAAGCTTGTGTTTTTGACCGCTCTGCGTCGTCGCGTGATGCTCTCCAGCGTCACCCTCTCGTCATACTATGTCAACG

[0184] GCGCACCCCCGGACACGCTATCCCTGATGGCGGCGTTTCGTAGGCGTTTTTCCCGCTATAATACAGCGCGTGCTGCCC

[0185] AACAAAATGATAGCCGCCGCCCTGGGAGTCGCACCGCTTCCTCCCGGGGCGTTCATACAGAACACAGGCCCGTTTGA

[0186] CCTGTGCAACGGGGACTCTGTGTGCGCGCTGCCTCCCATTTTGGACGTGGAGGACAAGCTGCGCCTAGGATCTGTGG

[0187] GCGAGGAA

[0188] The detection probe designed according to Fragment 3 is:

[0189] GCTCTGCGTCGTCGCGTGATGCTCTCCAGCGTCACCCTCTCGTCATACTATGTC (SEQ ID NO: 7)

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a gene chip for detecting pathogen of equine infectious virus. The gene chip comprises a solid phase carrier and an oligonucleotide probe fixed on the carrier, wherein the oligonucleotide probe comprises a detection probe and a quality control probe; and the detection probe is a nucleic acid fragment selected from the nucleotide sequences of rabies virus, equine infectious arteritis virus, equine infectious rhinopneumonitis virus and equine infectious equine infectious anemia virus. The invention also relates to a method for preparing the gene chip and a method for detecting four equine infectious diseases viruses by means of the chip, comprising the steps of probe synthesis, chip preparation and hybridization with a treated and labeled to-be-detected sample. The invention further relates to a reagent kit which is used for detecting pathogen of equine infectious virus and consists of the chip, a sample treatment reagent, a hybridization reagent, a colour-producing reagent and a specification. The gene chip can detect four viruses at the same time, and has the advantages of simple operation, high accuracy and strong repeatability, and the gene chip is of great significance to both laboratory research and production practice.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a gene chip for detecting horse infection virus pathogens, a preparation method of the chip, a detection method and a detection kit. Background technique [0002] Equine infectious rhinopneumonia, equine infectious arteritis, and equine infectious anemia are listed as second-class animal infectious diseases by the Ministry of Agriculture of my country. Rabies is an important zoonotic disease, and it is also an animal infectious disease that animal quarantine departments around the world focus on preventing. my country's Quality Supervision, Inspection and Quarantine Bureau listed it as a necessary quarantine disease for entry-exit inspection and quarantine of equine animals. Conventional equine infectious virus detection techniques include microbial culture technology, immune technology, PCR technology, etc. These technologies have the following defects: microbial cul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12M1/00
Inventor 周骋姚志建逄建涛姜存
Owner IPE BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com