Method for improving doramectin preparing bacterium with genome reorganization technique
A doramectin and gene technology, applied in the field of cell biology, can solve the problems of decreased yield of target protein, cumbersome steps and high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0087] The present invention first establishes a new bacterial strain for preparing protoplast fusion-using marker plasmid to screen protoplast fusion. The method has the advantages of being easy to mark and remove the mark, and after removing the resistance mark, subsequent genetic manipulations, such as fusion again, can be conveniently performed. The method of the invention can be conveniently used for strain breeding and improvement based on gene shuffling technology, and has simple operation, low cost and low equipment requirement.
[0088] Based on the method for preparing a protoplast fusion strain, one or more protoplast fusion selections can be performed to obtain a strain with a certain excellent property (such as high doramectin production).
Embodiment 1
[0235] Construction of doramectin-producing bacteria by fusion
[0236] 1. The bkdF gene disruption strain of MMR78
[0237] The bkdF gene of MMR78 was interrupted by conventional PCR targeting technology, and the interrupted position was bases 5356308 to 5357522 on the chromosome of MMR78.
[0238] After interruption, this segment is replaced by the oriT+spc gene, the sequence of which is shown in SEQ ID NO:1.
[0239] The modified strain was obtained by using spc resistance selection, and the obtained strain was spc resistant.
[0240] 2. MMR78 olmA1 gene disruption strain
[0241] Using conventional PCR targeting technology, the olmA1 gene of MMR78 was interrupted, and the interrupted position was from base 3607909 to base 3626345 of MMR78 chromosome.
[0242] After interruption, this segment is replaced by oriT+apra gene, the sequence is as SEQ ID NO:2.
[0243] The modified strain was obtained by apra resistance selection, and the strain was apra resistant.
[0244] ...
Embodiment 2
[0251] Establishment of Protoplast Fusion Mutagenesis Method of Marker Plasmid
[0252] 1. Construction of marker vector pPFMtsr
[0253] Digest the pIJ702 plasmid (purchased from the Institute of Microbiology, Chinese Academy of Sciences) with endonuclease BclI to obtain the tsr-melC gene with BclI restriction sites at both ends, and clone it into the pSP72 plasmid digested with BglII (the same tail enzyme of BclI) Inside, the pQC156 plasmid containing tsr sites and the like was obtained.
[0254] Using the total chromosome of Streptomyces coelicolor A3 (2) (purchased from the Institute of Microbiology, Chinese Academy of Sciences) as a template, PCR amplification was performed with forward primer GAATTCGCAGCGTGAAGTAGTACC (SEQ ID NO: 7) and reverse primer GAATTCGGCCTCCTACTAGCGACC (SEQ ID NO: 8) , obtain the SCP2-oriC gene carrying EcoRI restriction sites at both ends, and clone it into the pQC156 plasmid that has been digested by EcoRI to obtain the pZR156 plasmid, which con...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap