Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method of recombination double expressions cultivated silkworm polyhedrosis baculovirus containing SOD gene

A baculovirus and construction method technology, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve problems such as cumbersome operations, host death, etc., and achieve the effect of stable gene expression products

Inactive Publication Date: 2008-05-21
ZHEJIANG UNIV
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Most of the recombinant baculoviruses constructed so far are polyhedron-deleted viruses. Because there are no polyhedron-embedded virus particles, this virus is inactivated by strong alkaline damage in the silkworm midgut, so it cannot be infected by oral feeding, and needs to be infected one by one. Individual injections inoculate and cause the death of the host, so that each batch of production must be inoculated with the virus, and the operation is cumbersome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1, the synthesis of Mn-SOD gene

[0028] The silkworm N4 silkworm variety was used as the material, and total RNA was extracted from 5th instar and 3rd day larvae with RNA extraction kit (TRIzol RNA extraction reagent kit), and detected by electrophoresis.

[0029] Design MnSOD primers. Forward primer 5'-atcg aattc ATGTTAATGTCACAAAGGATTG-3', reverse primer 5'gat ggtacc gcCTTGAGCGCTTTTTCATATCTCTG-3'. To facilitate cloning, EcoRI and KpnI restriction sites were introduced at the 5' ends of the forward and reverse primers.

[0030] Using total RNA as a template, in the universal primer oligo-dT 18 and reverse transcriptase (Super script II reversetranscriptase) to synthesize single-stranded cDNA, and then use this as a template to synthesize MnSOD gene by PCR under SOD forward and reverse primers. 1 minute at ℃, 1 minute at 55 ℃, 2 minutes at 72 ℃, a total of 35 cycles, and finally 10 minutes at 72 ℃.

[0031] The synthesized MnSOD gene was recovered by e...

Embodiment 2

[0032] Embodiment 2, the silkworm double expression recombinant vector construction containing SOD gene

[0033] Using the silkworm baculovirus DNA as a template and 5'BM PH: GTCGACAAGCTCTGTCCGT (for the 5'BMpromoter) and Polyhedrin 3'PstI: TTTTCTGCAGTTAATACGCCGGACCAGTG (the 3' of the Polyhedrin coding sequence) as primers, the silkworm polyhedrin gene was synthesized by PCR , and clone it into pFastBac Dual plasmid.

[0034] Digest pFastBacHTa / MnSOD and the double expression plasmid containing the silkworm polyhedron gene with NcoI and KpnI restriction endonucleases respectively, recover the target fragment from the gel, and insert the MnSOD gene under the P10 promoter of the double expression vector to construct a double expression vector: Bm polyhedrin pFB dual / MnSOD.

Embodiment 3

[0035] Embodiment 3, the silkworm double expression recombinant virus construction containing MnSOD gene

[0036] Transfect Bm polyhedrin pFB dual / MnSOD into E.coli DH10Bac / BmNPV, culture at 37.5°C for 24-48 hours, each culture plate produces an average of 264 plaques for 40 hours, and the white spot rate is 4.5%. Select easy-to-separate, independent white spots 6 were cultured overnight on a liquid medium containing 50 μg / ml kanamycin, 7 μg / ml gentamycin, and 10 μg / ml tetracycline, and the double-expressed viral DNA containing MnSOD gene and polyhedron gene was collected and extracted;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for constructing a recombinant double-expression silkworm polyhedral baculiform virus which contains the SOD gene comprises that the general RNA of the silkworm is extracted and an MnSOD primer is designed; a single-stranded cDNA is synthesized and an MnSOD gene is synthesized; the MnSOD gene is connected with a p FastBacHTa to transform XL-Blue cells; and the recombinant donor plasmid p FastBacHTa / MnSOD can be extracted; the baculiform virus DNA of the silkworm is taken as the template to synthesize the silkworm polyhedral gene and the gene is cloned to the p FastBac Dual plasmid; the MnSOD gene is inserted under the P10 promoter of the double-expression plasmid to construct the double-expression vector: Bm polyhedrin pFB dual / MnSOD; after the transinfection of the Bm polyhedrin pFB dual / MnSOD, the double-expression virus DNA which contains the MnSOD gene and the polyhedral gene is distilled; the DNA is transduced into the silkworm culture cell of transinfection with the mediation of transinfection reagent lipidosome to obtain the recombinant virus. Virus particles which can feed and infect the silkworm is provided and the object gene MnSOD is expressed by the silkworm and large-scale and industrial production is realized.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to a method for producing MnSOD by genetic engineering. Specifically, the present invention relates to a method for constructing a recombinant double-expression silkworm baculovirus containing SOD gene and polyhedron gene. Background technique [0002] Superoxide dismutase (SOD) can keep free radicals in the human body in a "homeostasis". Superoxide dismutase removes superoxide free radicals to prevent direct or indirect damage to the body; SOD makes O 2 ·- Become a sewage tank for free radicals in cells; regulate O in the body 2 ·- level; regulate the level of NO in the body; catalytic reaction product H 2 o 2 The role of ("Theory and Application of Free Radical Biology" pp178-180). [0003] Most of the commercially available SOD is extracted from the livers of mammals such as cattle and pigs. With the prevalence of mad cow disease, mouth-to-mouth disease, and avian flu, there are ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/866C12N15/53C12N15/33C07H21/04
Inventor 缪云根岳万福
Owner ZHEJIANG UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More