Construction method of recombination double expressions cultivated silkworm polyhedrosis baculovirus containing SOD gene
A baculovirus and construction method technology, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve problems such as cumbersome operations, host death, etc., and achieve the effect of stable gene expression products
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0027] Embodiment 1, the synthesis of Mn-SOD gene
[0028] The silkworm N4 silkworm variety was used as the material, and total RNA was extracted from 5th instar and 3rd day larvae with RNA extraction kit (TRIzol RNA extraction reagent kit), and detected by electrophoresis.
[0029] Design MnSOD primers. Forward primer 5'-atcg aattc ATGTTAATGTCACAAAGGATTG-3', reverse primer 5'gat ggtacc gcCTTGAGCGCTTTTTCATATCTCTG-3'. To facilitate cloning, EcoRI and KpnI restriction sites were introduced at the 5' ends of the forward and reverse primers.
[0030] Using total RNA as a template, in the universal primer oligo-dT 18 and reverse transcriptase (Super script II reversetranscriptase) to synthesize single-stranded cDNA, and then use this as a template to synthesize MnSOD gene by PCR under SOD forward and reverse primers. 1 minute at ℃, 1 minute at 55 ℃, 2 minutes at 72 ℃, a total of 35 cycles, and finally 10 minutes at 72 ℃.
[0031] The synthesized MnSOD gene was recovered by e...
Embodiment 2
[0032] Embodiment 2, the silkworm double expression recombinant vector construction containing SOD gene
[0033] Using the silkworm baculovirus DNA as a template and 5'BM PH: GTCGACAAGCTCTGTCCGT (for the 5'BMpromoter) and Polyhedrin 3'PstI: TTTTCTGCAGTTAATACGCCGGACCAGTG (the 3' of the Polyhedrin coding sequence) as primers, the silkworm polyhedrin gene was synthesized by PCR , and clone it into pFastBac Dual plasmid.
[0034] Digest pFastBacHTa / MnSOD and the double expression plasmid containing the silkworm polyhedron gene with NcoI and KpnI restriction endonucleases respectively, recover the target fragment from the gel, and insert the MnSOD gene under the P10 promoter of the double expression vector to construct a double expression vector: Bm polyhedrin pFB dual / MnSOD.
Embodiment 3
[0035] Embodiment 3, the silkworm double expression recombinant virus construction containing MnSOD gene
[0036] Transfect Bm polyhedrin pFB dual / MnSOD into E.coli DH10Bac / BmNPV, culture at 37.5°C for 24-48 hours, each culture plate produces an average of 264 plaques for 40 hours, and the white spot rate is 4.5%. Select easy-to-separate, independent white spots 6 were cultured overnight on a liquid medium containing 50 μg / ml kanamycin, 7 μg / ml gentamycin, and 10 μg / ml tetracycline, and the double-expressed viral DNA containing MnSOD gene and polyhedron gene was collected and extracted;
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com