Dunaliella salina EPSP synthetase and preparation method and application thereof
A Dunaliella salina and enzyme synthesis technology, applied in biochemical equipment and methods, DNA preparation, enzymes, etc., can solve problems such as lethal effects of crops, and achieve the effect of promoting production and development
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] The preparation of embodiment 1 Dunaliella salina EPSP synthetase gene
[0018] 1. Collection of Dunaliella salina
[0019] Dunaliella salina was purchased from the algae bank of Wuhan Institute of Hydrobiology, Chinese Academy of Sciences.
[0020] 2. Poly A + RNA isolation (Poly A + RNA isolation)
[0021] Total RNA of Dunaliella salina was extracted with Trizol reagent (purchased from Gibco). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis. The mRNA of Dunaliella salina was extracted using the kit instruction manual provided by Olidotex mRNA Kits (purchased from Qiagen).
[0022] 3. Construction of Dunaliella salina cDNA library (Cloning ofFull-length cDNA)
[0023] use SMART TM cDNA Library Construction Kit (purchased from ClonTech) provides the kit instructions, using λTriplEX2 (purchased from ClonTech) as a vector to construct the cDNA library of Dunaliella salina.
[0024] 4. Full-length cloning of Dunaliella salina...
Embodiment 2
[0036] The construction of embodiment 2 Dunaliella salina EPSP synthetase recombinant plasmid II
[0037] According to the full-length coding sequence of the Dunaliella salina EPSP synthetase gene prepared in Example 1, and under the condition of ensuring the correct reading frame, design primers that can amplify the complete coding reading frame, forward direction: 5'TCTGCTACTTTGGCGGCTCACAG3' , Reverse 5'AAGGACCCCAGGACTCAGAAGTCC3', and restriction enzyme cutting sites EcoRI and Xho I were introduced on the forward and reverse primers respectively. After PCR amplification, the Dunaliella salina EPSP synthetase gene TA was cloned into the intermediate vector pMD18-T (purchased from TaKaRa). The intermediate vector pMD18-T inserted with the Dunaliella salina EPSP synthetase gene was digested with EcoR I and Xho I, and the Dunaliella salina EPSP synthetase gene fragment was recovered. The expression vector pGEX-4T-1 (purchased from Amersham) was digested with EcoR I and Xho I, a...
Embodiment 3
[0038] Example 3 Activity Identification of Dunaliella salina EPSP Synthetase Gene
[0039] The Dunaliella salina EPSP synthetase recombinant plasmid constructed in Example 2 was transformed into Escherichia coli JM109 for functional identification of the enzyme.
[0040] 1. Identification of in vivo activity
[0041]Select the Escherichia coli JM109 transformed into the Dunaliella salina EPSP synthetase gene, and select the Escherichia coli JM109 transformed into the pGEX-4T-1 empty vector and the wild type Escherichia coli JM109 as controls. The same amount of glyphosate was added, and the biological function of the transformed Dunaliella salina EPSP synthetase was determined by comparing the inhibition of the control bacteria and the positive bacteria. Experiments showed that the Escherichia coli transformed with Dunaliella salina EPSP synthetase gene had obvious resistance to glyphosate.
[0042] 2. Identification of in vitro activity
[0043] Through the GST fusion exp...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com