Tumor correlated albumen, coding gene and application thereof
A tumor-related, gene-encoding technology, applied in the field of tumor-associated proteins and their encoding genes and applications, can solve unproven problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Cloning of embodiment 1, DENND2D-v2 and DENND2D-v1 and cDNA gene thereof
[0054] The specific primer sequences for the full-length reading frames of the DENND2D-v1 and DENND2D-v2 genes were respectively designed for the sequences 1 and 2 in the sequence list as follows:
[0055] DENND2D-v1:
[0056] Upstream primer 5'CCAGAGATGGAAGGACAAGTG3'
[0057] Downstream primer 5'GTCATTCTTATTCACCACAGCTC3'
[0058] DENND2D-v2:
[0059] Upstream primer 5'CACTCCAGGGGCCATGGATG3'
[0060] Downstream primer 5'GTCATTCTTATTCACCACAGCTC3'
[0061] Using the above primers, the human normal lung tissue cDNA library (Clontech: K1420-1) was used as a template for PCR amplification reaction, and the reaction conditions were as follows:
[0062] The reaction volume is 50 μl, which contains:
[0063] Human normal lung tissue cDNA template 5μl (5ng)
[0064] Primers The final concentration of forward primer and reverse primer is 0.2 μM each
[0065] dNTP final concentration 200μM each
[...
Embodiment 2
[0072] Example 2, RT-PCR detection of the expression levels of DENND2D-v1 and DENND2D-v2 genes in lung cancer-related cell lines and lung cancer tissues
[0073] In order to detect the difference in the expression of DENND2D-v1 and DENND2D-v2 genes between tumor and normal tissue cells, this example extracted the total RNA of lung cancer-related cell lines, and used RT-PCR to detect the changes in mRNA transcription.
[0074] 1. Expression levels of DENND2D-v1 and DENND2D-v2 in lung cancer-related cell lines
[0075]Detect the following lung cancer related cell lines: PAa (human lung adenocarcinoma cell line), A549 (human lung adenocarcinoma cell line, ATCC, CCL-185), GLC-82 (human lung adenocarcinoma cell line), LTEP (human lung adenocarcinoma cell line), cancer cell line), H520 (human lung squamous cell line, ATCC, HTB-182), H2170 (human lung squamous cell line, ATCC, CRL-5928), PG (human lung large cell carcinoma cell line), H460 ( Human lung large cell carcinoma cell line...
Embodiment 3
[0112] Example 3. In order to detect the expression of DENND2D-v2 protein, Anti-DENND2D-v2 antibody was prepared
[0113]The GPA project team of Beijing Institute of Genomics, Chinese Academy of Sciences was entrusted to prepare and purify DENND2D-v2 polyclonal rabbit antibody, and the antigen used was purified GST-DENND2D fusion protein. Antibody specificity was identified by Western Blot method. The specific operation process is as follows:
[0114] 1. Expression of DENND2D-v2 protein
[0115] Using primers Sense: 5'CCGGAATTCATGGATGGGCTCGGCCGCC3' and Antisense: 5'CCGCTCGAGCGGTTATTCACCACAGCTCTTA3', use pcDB3.1-DENND2D-v2 as a template to PCR amplify the fragment containing sequence 2, respectively digest PCR products with EcoRI and XhoI (Promega) and express in prokaryotic Carrier PGEX-4T-1 (Amersham), recover the digested product, and connect to obtain the pGEX-DENND2D-v2 fusion protein expression vector containing the DENND2D-v2 gene (the N-terminus of the DENND2D-v2 prot...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com