Reactor
A technology of a reactor and a reaction tank, applied in the field of reactors, can solve the problems of large pressure drop in the bed, difficult to feed and vent gas, shortened service life, etc., to achieve the improvement of the reaction speed, the shortened reaction time, and the avoidance of the decline of vitality. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0051] Example 1. The monolithic open-pore D-amino acid oxidase immobilized enzyme is directly used as a stirring paddle for batch stirring reaction to prepare glutaryl-7-aminocephalosporanic acid (GL-7-ACA)
[0052] First, a honeycomb immobilized D-amino acid oxidase block was prepared as follows.
[0053] D-amino acid oxidase converts cephalosporin C to glutaryl-7-aminocephalosporanic acid (GL-7-ACA). BL-HS-GHA [E. coli BL21(DE3)pLysS containing recombinant D-amino acid oxidase GHA] Escherichia coli cells were prepared in the following manner.
[0054] Source of BL-HS-GHA:
[0055] According to the known DNA sequence of Thermoanaerobacterium saccharolyticum glucoseisomerase (GenBank L09699), PCR primers were designed, specifically:
[0056] Upstream primer GI-NdeI:
[0057] 5’-AGCCTAGGTTAATTAACTTTAAGAAGGAGATATACATATGAATAAATATTTTGAGA
[0058] Downstream primer GI-EcoRI:
[0059] 5’-ATAAGCTCAGCGGCGCGCCTTATTCTGCAAACAAATAC
[0060]Using Thermoanaerobacterium saccharolyticu...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com