Molecule tag close linked to resistance QTL of wheat sharp eyespot, and application
A wheat sheath blight and molecular marker technology, applied in the field of wheat breeding and molecular biology, to reduce workload, improve accuracy and breeding efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Determination of Resistance Source CI12633 to Wheat Sheath Blight
[0018] 1. Obtain the DNA of wheat variety CI12633
[0019] The leaves of the plants of the wheat variety CI12633 were separated and extracted by using the CTAB extraction method to extract the DNA.
[0020] 2. Detect the DNA of wheat variety CI12633, and screen out the molecular markers closely linked to the wheat sheath blight resistance QTL
[0021] The obtained DNA was amplified by PCR right border primers and left border primers 5'CGCTGAAAAGAAGTGCCGCATTATGA3' and 5'CGCTGCCTTTTCTGGATTGCTTGTCA3, and the amplified product was separated by electrophoresis on a 6% polyacrylamide gel, and the molecular marker gwm608 with a size of 180 bp was obtained .
[0022] The obtained DNA was amplified by using the primers 5'CACTACAACTATGCGCTCGC3' and 5'TCCATTGGCTTCTCTCTCAA3' of the PCR right boundary primer and the left boundary primer, and the amplified product was separated by electrophoresis on a 6% polyacryla...
Embodiment 2
[0029] The molecular markers gwm608, gwm88, wmc727 and gwm410.2 with sizes of 180bp, 130bp, 200bp and 300bp were used to predict the resistance of wheat variety CI12633 to sheath blight resistance.
[0030] The wheat variety CI12633 was crossed with Yangmai 158 and propagated to F 8 The progeny of offspring, DNA was first isolated from their leaves, and then polymerase chain reaction (PCR) was carried out on these DNAs with primers of molecular markers gwm608, gwm88, wmc727 and gwm410.2 [isolation and extraction of DNA and PCR amplification and electrophoresis The isolation process is the same as in Example 1], judge whether there are at least three of the above-mentioned markers in the isolates after the PCR of these DNAs, if there are more than three of the above-mentioned markers at the same time, it means that the resistance of the strain to sheath blight has reached "moderate resistance" Above level, can not exist at the same time more than three above-mentioned marks and...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com