Fishes infectious spleen and kidney necrosis virus gene engineering vaccine and preparation method thereof
A technology of genetically engineered vaccines and spleen-kidney necrosis virus, applied in genetic engineering, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as harm, unfavorable immunopathological reactions, unexpected biological activity of antigens, etc., and achieve production Low cost, simple preparation process, good growth effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0066] Vaccine Composition:
[0067] This vaccine consists of a protein solution containing two gene recombinant protein protein-24 and protein-50 antigens and an adjuvant (MONTANIDE ISA 763A, seppic, france),
[0068] The preparation of the gene recombinant protein protein-24 and protein-50:
[0069] Two open reading frames (Open Reading Frame, ORF) ORF24 and ORF50 encoding ISKNV envelope protein were screened in the ISKNV genome. ORF24 encodes a protein with a length of 313AA and a transmembrane region at position 148-170. The length of ORF50 encoded protein is 143AA. There is a transmembrane region at the 116-138AA position.
[0070] The ORF base sequence used is:
[0071] ORF24:
[0072] ATGGATAAGTATGTGCTCAGACCAAGCGACCCACATTTGTGGGCCATGTACAAGAAGGCCGTTGCGTCTTTTTGGACCGT
[0073] TGAGGAGGTGGATCTTAGTACTGATGTACGCCATTGGACAGAAAAACTGACCGAGGCTGAGCGCAGGTTCATGTCTCACA
[0074] TACTGGCATTCTTTGCAATGGCAGATGGCATTGTAGGCGACAACCTTGTGTGCAATTTCGCAAAAGAACTTGACTATATT
[0075] CCAGAAGCCAGA...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap