Desmocyte growth factor 11 antibody, antagonist and agonist
A cell and antibody technology, applied in biological testing, anti-fungal/algae/lichen immunoglobulin, material inspection products, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0138] Example 1 Bacterial expression and purification of FGF-11 protein
[0139] Amplification of the DNA sequence encoding FGF-11 was initiated using PCR oligonucleotide primers, ATCC #97150, which correspond to the 5' sequence of the processed FGF-11 protein (minus the signal peptide sequence) and the FGF-11 Vector sequences 3' of the 11 genes. Additional nucleotides corresponding to the FGF-11 gene were added to the 5' and 3' sequences, respectively. The 5' oligonucleotide primer 5'CGCGGATCCATCATGAGTGGAAAGGTGACCAAG 3' (SEQ ID NO: 3) contains a BamHI restriction endonuclease site. The 3' sequence 5'CGCGGATCCCGTTGATTCATTGTGGCTCAT 3' (SEQ ID NO: 4) contains the sequence complementary to the BamHI site followed by 21 nucleotides of the FGF-11 coding sequence.
[0140] The restriction enzyme sites correspond to the restriction enzyme sites of the bacterial expression vector pQE-60 (Qiagen, Chatsworth Corporation, CA, 91311). pQE-60 encodes antibiotic resistance (Amp r ), ba...
Embodiment 2
[0140] The restriction enzyme sites correspond to the restriction enzyme sites of the bacterial expression vector pQE-60 (Qiagen, Chatsworth Corporation, CA, 91311). pQE-60 encodes antibiotic resistance (Amp r ), bacterial origin of replication (ori), IPTG regulatable promoter operator (P / O), ribosome binding site (RBS), 6-histidine tag and restriction endonuclease sites. pQE-60 was then digested with NcoI and BamHI. The amplified sequence was ligated into pQE-60 and inserted in frame with the histidine tag coding sequence and ribosome binding site (RBS). The ligation mixture was then used to transform E. coli strain M15 / rep4 (Qiagen, Inc.) by the method described by Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1989)). M15 / rep4 contains multiple copies of the plasmid pREP4, which expresses the lacI repressor and confers kanamycin resistance (Kan r ). Transformants were identified by their ability to grow on LB plates, and a...
Embodiment 3
[0143] Example 3 Cloning and expression of FGF-11 using the baculovirus expression system
[0144] The DNA sequence encoding the full-length FGF-11 protein (ATCC #97150) was amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
[0145] The FGF-11 5' primer has the sequence 5'CGCGGATCCATCATGAGTGGAAAGGTGACCAAG 3' (SEQ ID NO: 5) and contains a BamHI restriction site (bold) so that cloning at this site places the baculovirus signal sequence in the putative FGF -11 signal peptide cleavage site downstream of the FGF-11 gene 21 nucleotide reading frame.
[0146] The 3' primer has the sequence 5'CGCGGTACCCTACGTTGATTCATTGTGGCT 3' (SEQ ID NO: 6), contains a cleavage site for restriction endonuclease Asp718 and 21 nucleotides complementary to the 3'-untranslated sequence of the gene.
[0147] The amplified sequence was separated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Company, La Jolla, Ca.). The fragmen...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com