Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human DNA polymerase beta mutant gene and its corresponding protein

A technology of polymerase and DNA molecules, applied in recombinant DNA technology, DNA/RNA fragments, genetic engineering, etc., can solve problems such as poor stability and loss of activity, and achieve the effect of improving postoperative survival rate

Inactive Publication Date: 2002-08-28
ZHENGZHOU UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the stability of the enzyme is poor, and the enzyme is more likely to lose activity when overheated (>42°C)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human DNA polymerase beta mutant gene and its corresponding protein
  • Human DNA polymerase beta mutant gene and its corresponding protein
  • Human DNA polymerase beta mutant gene and its corresponding protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Cloning of M-POLB gene As shown in Figures 1, 2, 3, and 4, the acquisition approach of the M-POLB gene of the present invention and the M-POLB gene nucleotide sequence reading frame analysis are as follows 1. Tissue separation Surgical specimens of esophageal cancer tissue from invasive cancer in Linzhou City, Henan Province, a high-incidence area of ​​esophageal cancer in China, were collected at the surgical site and stored in -196°C liquid nitrogen immediately. 2. Isolation of mRNA was selected with QIAGEN Total RNA Extraction Kit (according to the extraction kit) 3. Reverse transcription to synthesize cDNA fragments

[0039] 5×RT buffer (containing 50mmol / LMgCl 2 ) 6μl, 10mmol / L 4×dNTP 2μl, RNasin 40U, AMV 2U, downstream primer (P25'TCATTCGCTCCGGTCCTTGG 3') 1μl, extracted total RNA 5μl, DEPC water to make up 30μl, topped with 2 drops of liquid paraffin, reverse transcription in 42℃ water bath 45min. 4. PCR amplification and cloning

[0040] Amplificati...

Embodiment 2

[0052] 310 320 330 340 350 M13140 301 LGVTGVAGEP LPVDSEKDIF DYIQWKYREP KDRSE..... 350 M-POLB 301 ---------- --------- ---------- -----............... 350 Example 2: Gene detection method for M-POLB gene feature points

[0053] Design probes to detect the deletion of the characteristic point 177-234 of the M-POLB gene. The designed probes are used to detect the M-POLB gene of the present invention. Design probes may contain some or all of the following nucleotide sequences or complementary sequences:

[0054] 5'CTCGCAAACTTTGAGAAGAACGTGAGCCAAGCTATCCACAAGTACAATGCTTACAGAA 3'

[0055] See molecular cloning for specific nucleic acid molecular hybridization methods. If the hybridization reaction is positive, it can be diagnosed as esophageal cancer at an early stage.

[0056] PCR amplification to detect the missing primers at positions 177-234 of the M-POLB gene feature point, such as: upstream primer 5′GTCCTGGTACCTCCTTCAA 3′ downstream primer 5′ACTCGTATCATCCTGC...

Embodiment 3

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a cDNA sequence of human repair gene DNA polymerase beta, which is a specific representation of DNA polymerase beta in esophagus cancer. The protein coded by it has fully lost the DNA repair activity of DNA polymerase beta. It can be used for early diagnosis and gene therapy of esophagus cancer.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a new human gene nucleotide sequence, in particular to a cDNA sequence of human repair gene DNA polymerase β, which is a special expression form of DNA polymerase β in esophageal cancer, called For M-POLB, the protein it encodes completely loses the DNA repair activity of DNA polymerase β, and the protein is called M-POLB.AMI. That is, the present invention relates to the cDNA coding sequence of the gene, the polypeptide encoded by the nucleotide sequence and the method for producing the new M-POLB.AMI by recombinant technology. Background technique [0002] In 1971, Weissbach et al. isolated a new DNA polymerase different from DNA polymerase α from bovine thymus, and named it DNA polymerase β (Polymerase β, POLB), which is called DNA-dependent DNA polymerase β. It is one of five DNA polymerases known so far in eukaryotes. Some people call it the "...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/11C12N15/12C12N15/52
Inventor 董子明赵国强赵勤谭晓辉杨洪艳薛乐勋
Owner ZHENGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com