Sheep growth hormone releasing hormone gene and its expression product and application

A growth hormone and hormone-releasing technology, which can be used in sugar derivatives, drug combinations, medical preparations containing active ingredients, etc., and can solve the problems of short half-life and inconvenient production.

Inactive Publication Date: 2007-06-06
北京济普霖生物技术有限公司 +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the half-life of GHRH is very short, only ten minutes in the body. Therefore, in actual application, injection of GHRH has brought a lot of inconvenience to production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sheep growth hormone releasing hormone gene and its expression product and application
  • Sheep growth hormone releasing hormone gene and its expression product and application
  • Sheep growth hormone releasing hormone gene and its expression product and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0116] Embodiment 1, the construction of expression clone

[0117] 1. Construction elements of expression cloning

[0118] 1. 5' flanking nucleotide sequence

[0119] The 5' flanking nucleotide sequence was transformed from the bovine skeletal muscle actin promoter

[0120] Primers were designed as follows:

[0121] up: CTGGGGAGGAGGGTTTCGTATGT

[0122] LENGTH: 23nt ΔG=-3.6kcal / mol (G+C)%=56.5% Tm=72

[0123] Low: TCTGGTTTCTGCAAGGACAGG

[0124] SnaBI

[0125] LENGTH: 28nt ΔG=-6.9kcal / mol (G+C)%=50.0% Tm=72

[0126] The following is a comparison of the 5' flanking nucleotide sequence obtained by PCR with the above primers and the reported bovine skeletal muscle actin promoter sequence (GENEBANK sequence number is U02285), and the homology is 99%.

[0127] Upper line: 5' flanking nucleotide sequence obtained by PCR with the above primers

[0128] from 1 to 2445

[0129] Lower line: Reported bovine skeletal muscle actin promoter

[0130] ...

Embodiment 2

[0304] Embodiment 2, expression plasmid promotes sheep growth in vivo

[0305] Injection method: 1.2-1.5 mg / head of the expression plasmid of the present invention is injected into the muscles on both sides of the buttocks once. The growth-promoting effect after injection is shown in Table 2.

[0306] For the specific operation method in this example, refer to the corresponding part in the "Molecular Cloning Experiment Guide" (Second Edition) published by Science Press. In the experiment, half of rams and half of ewes were divided into random groups. The feeding method is basically grazing, and the concentrate is rarely supplemented.

[0307] Variety

character

Xinjiang Kazakh sheep

Mongolian Ujimqin sheep

Shandong Small Tail Han Sheep

test group

control group

test group

control group

test group

control group

Head count

15

20

12

22

20

25

Bod...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention aims at providing sheep growth hormone releasing hormone gene and its encoded sheep growth hormone releasing hormone. The gene can be well expressed in animal body and behaves as the obvious improvement of animal growth characteristics. The nucleotide sequence of the sheep growth hormone releasing hormone gene consists of 135 nucleotides and encodes protein comprising 44 amino acid residues. The present invention also aims at providing one guide peptide to replace GHRH to ensure the guide protein to be secrete to outside cell and enter into body fluid circulation. Medicine with the present invention as active component may be used in promoting growth hormone secretion of sheep, improving growth characteristic of sheep and treating muscular dystrophy diseases.

Description

technical field [0001] The invention relates to an artificially synthesized gene and its expression product and application, in particular to an artificially synthesized sheep growth hormone releasing hormone gene and its expression product and application. Background technique [0002] Growth hormone releasing hormone (Growth Hormone Releasing Hormone, GHRH) is a polypeptide hormone secreted in the hypothalamus of animals. Its mechanism of action is that growth hormone-releasing hormone, as a positive regulator of growth hormone (GH), can promote the synthesis and secretion of growth hormone by the pituitary gland, increase the level of growth hormone in the body, and induce systemic insulin-like effects through growth hormone. The level of growth factor (Insulin-like GrowthFactor I, IGF-I) is increased, thereby improving the production performance of animals. Therefore, GHRH has important application value in animal husbandry. [0003] 1. The rise of GHRH research [00...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07H21/04A61K31/7088A61K38/22A61P21/00
Inventor 孟庆勇李宁
Owner 北京济普霖生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap