Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Highland barley drought-resistant related gene and kit and method for identifying drought-resistant highland barley

A kit and highland barley technology, applied in botany equipment and methods, biochemical equipment and methods, genetic engineering, etc., to achieve the effect of simple method, low sequencing length and low requirements

Pending Publication Date: 2022-07-19
AGRI RES INST TIBET ACADEMY OF AGRI & ANIMAL HUSBANDRY SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no research on the drought-resistant genes and their applications for drought-resistant highland barley to improve the drought-resistant ability of highland barley

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Highland barley drought-resistant related gene and kit and method for identifying drought-resistant highland barley
  • Highland barley drought-resistant related gene and kit and method for identifying drought-resistant highland barley

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1, identification of drought-resistant highland barley

[0027] First, synthesize primer pairs for drought resistance genes:

[0028] F: CACGGGATGCGACAGAGACC (SEQ ID NO. 2);

[0029] R: GCTGATCCGGCAATCCGAGC (SEQ ID NO. 3).

[0030] Use the following methods to identify:

[0031] a) Using the TGuide OSR-M301 kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. to extract the total genomic DNA of the highland barley leaf tissue to be inspected;

[0032] b) using the total genomic DNA described in step a) as a template, using the synthesized primer pair to carry out a PCR reaction, wherein the reaction system is 25 μL, and the annealing temperature is 60°C;

[0033] c) Perform 1% agarose gel electrophoresis detection on the PCR product obtained in step b), and observe a bright band of about 3Kb;

[0034] d) Sanger sequencing by capillary electrophoresis is performed on the PCR product of step c) to obtain a gene sequencing peak map of SEQ ID NO: 1;

[...

Embodiment 2

[0037] Example 2 Genetic research on drought resistance of highland barley

[0038] The present invention collects 246 highland barley germplasm resources from all over the world, extracts DNA and obtains resequencing data based on second-generation sequencing. Based on the Illumina Hiseq 2000 sequencing platform, a total of 10.44Tb of sequencing data were obtained, and the coverage rate of each sample exceeded 8.5. These reads were mapped to the IBSC_v2 reference genome (Mascher et al., 2017), which was well assembled and annotated, with an average read mapping rate of approximately 86.69% across all samples. After SNP Calling, the present invention selected SNPs with deletion calling frequency less than 10% and minor allele frequency greater than 5%, resulting in a total of 7,744,571 SNPs ranging from 893,125 (chr1H) to 1,508,037 (chr2H) per chromosome, each The maximum number of SNPs for Mb is 6,979. In addition, the nucleotide diversity π (window 1Mb) ranged from 2.2E-07...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a highland barley drought resistance related gene as well as a kit and a method for identifying the drought resistance of highland barley. The nucleotide sequence of the highland barley drought resistance related gene is shown as SEQ ID NO: 1. The sensitivity degree of the to-be-detected highland barley to drought can be judged by detecting the specific SNP genotype of the drought-resistant highland barley, and the requirement for the sequencing length is low. The SNP locus with one drought-resistant highland barley specific genotype is used for identifying the drought resistance, the method is simple, the result is accurate and reliable, and the SNP locus has practical application and popularization values.

Description

technical field [0001] The invention specifically relates to a drought-resistant highland barley related gene and a kit and method for identifying drought-resistant highland barley. Background technique [0002] Highland barley is the main food crop on the Qinghai-Tibet Plateau. Harsh environments such as long-term drought lead to a decline in the yield and quality of highland barley, which also makes highland barley an important resource for studying the mechanism of plant drought resistance. However, there is no research on the drought-resistant highland barley and its application research, so as to improve the drought-resistant ability of highland barley. Therefore, it is very important to study a method and reagent that can quickly and accurately identify the drought resistance of highland barley. SUMMARY OF THE INVENTION [0003] In order to solve the above problems, the present invention provides a highland barley related gene for drought resistance, the nucleotide ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/11C12Q1/6895C12Q1/6858
CPCC07K14/415C12Q1/6895C12Q1/6858C12Q2600/13C12Q2600/156C12Q2531/113C12Q2535/101C12Q2565/125
Inventor 徐齐君唐亚伟扎桑德青卓嘎刘仁建巴桑玉珍于明寨危文波原红军曾兴权
Owner AGRI RES INST TIBET ACADEMY OF AGRI & ANIMAL HUSBANDRY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com