Probe, kit and detection method for rapidly detecting bombyx mori nuclear polyhedrosis virus
A technology of nuclear polyhedron and detection method, which is applied in the field of probes for rapid detection of silkworm nuclear polyhedrosis virus, can solve the problems of cumbersome fluorescent quantitative PCR technology detection and high inspection facility conditions, and achieve the reduction of reagent mixing and sampling steps, Detect fast, time-saving effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0040] The present invention will be further described in detail below in conjunction with the embodiments, so that those skilled in the art can implement it with reference to the description.
[0041]
[0042] 1. Synthesis of probes and primers
[0043] Since the length of the probe sequence needs to be between 40-50bp, and the quenching group and the fluorescent group are respectively connected to a pair of thymine nucleotides, the pair of oligo-Ts are separated by 1-5 bases , one of the heterozygous 1-5 bases is replaced by tetrahydrofuran, pre-designed in the full-length 1755bp of the BmNPV ie-1 gene, the probe starts from 1469-1508bp, a total of 40bp, quencher group and fluorescent group The groups are respectively connected at positions 1493 and 1497, and the 149th thymine is replaced by tetrahydrofuran to form the desired detection probe (BmNPV-probe). The nucleotide sequence of BmNPV-probe is: TCAAAAACGAAGAGCGGTTGACTA / i6FAMdT / [THF]GC / iBHQ1dT / AAGAAAAACGA, based on t...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com