Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Parvoviral vectors and methods of making and use thereof

A technology of parvoviruses and vectors, applied in the direction of viruses/bacteriophages, biochemical equipment and methods, viruses, etc., which can solve the problems of reduced virus production yields and other issues

Pending Publication Date: 2021-11-05
耐克基因有限责任公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, recombinant parvoviruses often produce antisense RNA or dsRNA during replication, which can lead to lower viral production yields

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Parvoviral vectors and methods of making and use thereof
  • Parvoviral vectors and methods of making and use thereof
  • Parvoviral vectors and methods of making and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0112] Example 1: ubiquitously expressed miR-16-TS for antisense RNA and dsRNA elimination remove

[0113]The hsa-miR-16 sequence was obtained from the miRNA registry (Griffiths-Jones, 2004). RDDD with the miR-16 target sequence was synthesized and cloned into the factor VIII (FVIII) expression construct pAAV-F8, which has the B domain deleted under the control of the liver-specific promoter TTR Factor VIII. The RDDD sequence with the miR-16 sequence inserted between the promoter and the FVIII start codon includes the sequence TAGCAGCACGTAAATATTGGCG (SEQ ID NO: 1). The underlined sequences in the GOI strands are designed to be exact matches to specific miRNAs. In the bottom strand, the sequence is perfectly complementary to a specific miRNA (miR-16 in this case). The resulting construct was pAAV-F8-miR-16-PG. Only one copy of the miRNA was used to avoid long gaps between the promoter and the GOI. The pAAV-F8-miR-16-PG-based vector was generated by a triple plasmid t...

Embodiment 2

[0114] Example 2: Multiple copies of miR-16-TS for antisense RNA and dsRNA depletion

[0115] RDDDs with four copies of the miR-16 target sequence were synthesized and cloned into the factor VIII (FVIII) expression construct pAAV-F8 with the liver-specific promoter TTR deleted for the B domain Factor VIII under control. Since there is no poly-A signal in the antisense strand of the promoter of the GOI, transcripts of antisense RNA and dsRNA will extend beyond the promoter and terminate at the ITR (which appears to function as a poly-A site). An RDDD with 4 copies of miR-16 was inserted between the promoter and the 5'ITR, including the following sequence: gtac TAGCAGCACGTAAATATTGGCG gctagc TAGCAGCACGTAA ATATTGGCG gtcagc TAGCAGCACGTAAATATTGGCG agctgc TAGCAGCACGTAAATATTGGCG cgta (SEQ ID NO: 2). The underlined sequences in the GOI strands were designed to exactly match specific miRNAs. In the bottom strand, these sequences are perfectly complementary to a specific mi...

Embodiment 3

[0116] Example 3: miR-16-TS and miR-122 for antisense RNA and dsRNA depletion in liver.

[0117] Since there is no poly-A signal in the antisense strand of the promoter of the GOI, transcripts of antisense RNA and dsRNA will extend beyond the promoter and terminate at the ITR (which appears to function as a poly-A sequence). In this study, with two copies of miR-16 and two copies of miR-122 ( CAAACACCATTGTCACACTCCA (SEQ ID NO:3) ) is inserted between the promoter and the enhancer and includes the following sequence: gtac CAAACACCATTGTCACACTCCA gctagc TAGCAGCAC GTAAATATTGGCG gtcagc CAAACACCATTGTCACACTCC Aagctgc TAGCAGCACGTAAATATTGGCG cgta (SEQ ID NO: 4)

[0118] The underlined sequences in the GOI strands were designed to exactly match specific miRNAs. In the bottom strand, these sequences are perfectly complementary to specific miRNAs (in this case miR-16 and miR-122). The resulting construct was pAAV-F8-miR-16-122-EP. The pAAV-F8-miR-16-122-EP based vector...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A recombination parvovirus vector that comprises a parvovirus capsid and a double-stranded vector genome having a sense-strand and an antisense-strand. The sense-strand comprises in the 5' to 3' direction: a parvovirus terminal repeat at the 5' end a coding sequence of a gene of interest (GOI); and a parvovirus terminal repeat at the 3' end. The vector genome further comprises a RNA destabilization / destruction domain (RDDD).

Description

[0001] This application claims priority to U.S. Provisional Application No. 62 / 949,052, filed December 17, 2019. technical field [0002] The present invention relates generally to vectors for gene transfer and gene therapy applications. In particular, the application relates to the management of undesired antisense RNA and double-stranded RNA (dsRNA) produced during the production of recombinant viral vectors, such as parvoviral vectors. Background technique [0003] Recombinant parvoviruses, such as adeno-associated virus (AAV), have been widely used as gene transfer vectors in the field of gene therapy. However, recombinant parvoviruses often produce antisense RNA or dsRNA during replication, which can lead to lower virus production yields. [0004] Therefore, there is a need for new parvoviral vectors that can be produced with high yields. Contents of the invention [0005] The present application describes parvoviral vectors having a viral genome with an antisense R...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/00C12N15/113C12N15/86
CPCC12N15/86C12N2750/14143C12N2310/111C12N2310/141C12N15/111C12N2330/51
Inventor 肖卫东余湘萍
Owner 耐克基因有限责任公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com