Targeted enrichment method for trace DNA and use thereof
A DNA-targeted and targeted technology, applied in the field of sequencing, achieves the effects of low cost, high capture efficiency, and reduced capture and library construction costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] In this example, a synthetic wild-type internal reference DNA sequence with 10,000 molecules of human cfDNA was incorporated, and a synthetic mutant internal reference DNA sequence was incorporated at the same time, so that the ratio of the number of molecules between the mutant type and the wild type was 0.5%. Using the method of the present invention The principle is to design mutant amplification primers for enrichment detection of mutant types, among which:
[0054] The wild-type DNA 5'→3' sequence is SEQID NO.2:
[0055] GTTGAACAATCGTCGCAATTTAGTCACAAAACAGTTACACAAACGTTGCAACGTGCGACTGTGTTCTGCTGTCGTCGCAAAAAAGTTGCACAAAGCGACTGTTTTGTGATATTTTGGAATAGGTCACAAGACAAACTTTTGAAATCCACA
[0056] Mutant DNA 5'→3' sequence is SEQID NO.3:
[0057] GTTGAACAATCGTCGCAATTTAGTCACAAAACAGTTACACAAACGTTGCAACGTGCGGCTGTGTTCTGCTGTCGTCGCAAAAAAGTTGCACAAAGCGACTGTTTTGTGATATTTTGGAATAGGTCACAAGACAAACTTTTGAAATCCACA
[0058] The stem-loop linker sequence used in this example is SEQID NO.1:
[0059] GATC...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap