Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of aminoglycoside antibiotic resistance gene detection primer and kit

A technology for aminoglycosides and antibiotic resistance, which is applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc. It can solve the problems of small throughput, heavy workload of calculating absolute copy number, high false positive, etc. problem, to achieve the effect of large detection throughput, rapid detection and guaranteed accuracy

Active Publication Date: 2022-07-26
ANHUI NORMAL UNIV +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] Aiming at the problems of low throughput of qPCR method in the prior art, high false positives, heavy workload for calculating absolute copy number, etc., the present invention provides primers and kits for high-throughput quantitative detection of aminoglycoside antibiotic resistance genes in the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of aminoglycoside antibiotic resistance gene detection primer and kit
  • A kind of aminoglycoside antibiotic resistance gene detection primer and kit
  • A kind of aminoglycoside antibiotic resistance gene detection primer and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] This example provides high-throughput quantitative detection primers for aminoglycoside antibiotic resistance genes. The high-throughput quantitative detection primer pairs for aminoglycoside antibiotic resistance genes are artificially synthesized and composed of 35 aminoglycoside antibiotic resistance genes. The sequence composition of primer pair and 16S rRNA gene standard is as follows:

[0087]

[0088]

[0089] The 16S rRNA gene standard sequence is as follows:

[0090]GCCCGTGACCTCGTCGTATTGACTGCATCGCGTGTCGCCCTTGATCCTAAACATAACCACTAACTGCAATATCTTATTATCATCATGTTCCACAGCTCCTCAGGCTTTATTCATGTCCATTCTTCATCAAATTCGTCATTTTTCACCAAAATGCATTGTGATAAACGATTATCACTTAAGATAATCGATTGTCTTAGTGAAATTTAACCAGAAACATCATGCAGGATGTGATAATTGAATATCAACCCAGATAATCAATTATTCCTAAAACCATTTTCAAAACCTACATGCAACTAATCAAAGGGCGACACGCGATTGCAGCGAGCCTCAGACACTGGCCGTCGTTTTACACAATCAAGTCGTGACTGGGAAAACCCTGGCGCTCACTGGCTCACCTTCACGGGTGGGCCTTTCTTCGGTAGAAAATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACC...

Embodiment 2

[0092] Based on the primer pairs obtained in Example 1, this example provides a kit, including the following contents:

[0093] A high-throughput quantitative detection kit for aminoglycoside antibiotic resistance genes in the environment, including 35 pairs of aminoglycoside antibiotic resistance genes and specific primers for the internal reference 16S rRNA gene, qPCR reaction reagents, smartchip chips and wafergen consumables.

[0094] Among them, the wafergen consumables include 384 deep-well plate, qPCR membrane, chip temporary sealing membrane, chip filter membrane and chip qPCR membrane.

[0095] The qPCR reaction reagents included 2×LightCycler 480SYBR Green IMaster, ROX, Oligo(F+R), 5 different serial dilutions of DNA standard plasmid and NF H 2 0.

Embodiment 3

[0097] A high-throughput quantitative detection method for aminoglycoside antibiotic resistance genes in the environment, which specifically includes the following steps:

[0098] 1: Standard curve drawing

[0099] Construction of 16S rRNA positive control

[0100] The first step: use 16S rRNA-specific primers to screen a large number of environmental samples, and the screening is to amplify the environmental samples by qPCR, and the environmental samples are nucleic acid samples;

[0101] Step 2: Observe the amplification curve and dissolution curve of qPCR, the dissolution curve has a single peak, the CT value of the amplification curve is less than 25, and the sample of this reaction is determined as a candidate sample corresponding to the specific primer;

[0102] Step 3: Amplify the corresponding candidate samples by PCR with 16S rRNA-specific primers;

[0103] Step 4: The PCR product is subjected to agarose electrophoresis, gel cutting recovery, and first-generation se...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of kits, and provides a high-throughput quantitative detection primer and a kit for aminoglycoside antibiotic resistance genes in the environment, including primers, qPCR reaction reagents, smartchip chips and wafergen consumables. The primers are composed of 35 pairs of Aminoglycoside antibiotic resistance gene and specific primers for internal reference 16SrRNA gene. The wafergen consumables include 384 deep-well plate, qPCR membrane, chip temporary sealing membrane, chip filter membrane and chip qPCR membrane. This kit can detect 144 an environmental sample. Using the wafergen platform for ARGs detection can well solve the shortcomings of the current qPCR method's low throughput. Self-written automated script to achieve fast absolute copy number calculation. The above 36 pairs of primers were pre-sprayed on the chip, and then assembled into a kit to facilitate the rapid detection of subsequent environmental detection points.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a primer and a kit for high-throughput quantitative detection of aminoglycoside antibiotic resistance genes in the environment. Background technique [0002] The widespread application of antibiotics in clinical medicine, animal husbandry, and agricultural pest control and other fields since their discovery has led to the spread of drug-resistant pathogens and resistance genes, and their harm has attracted worldwide attention. The World Health Organization (WHO) report in 2014 proposed that antibiotic resistance is the most serious human health challenge in the 21st century, and the regulation of global drug resistance needs to be strengthened. Studies have long proposed the use of resistance genes as a new environmental pollutant. [0003] Aminoglycoside antibiotics are spectrum, high-efficiency antibiotics, with many characteristics suitable for clinical treatment of infections, e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/686C12N15/11
CPCC12Q1/689C12Q1/686C12Q2561/113C12Q2563/107C12Q2545/114
Inventor 高轩张鸿李西清唐聪王丽达张慧
Owner ANHUI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com