Chicken PTF1a gene recombinant protein and preparation method of polyclonal antibody
A polyclonal antibody and gene technology, applied in the fields of botany equipment and methods, biochemical equipment and methods, genetic engineering, etc., can solve problems such as lack of PTF1a gene
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1: This example provides a method for preparing a chicken PTF1a gene polyclonal antibody, which includes gene synthesis, antigen purification, animal immunization, titer detection, antibody purification and verification, as follows.
[0027] 1. Synthesis of chicken PTF1a gene
[0028] 1. Amplification of the gene, enzyme digestion and connection with the vector
[0029] According to the Ptf1a gene CDS region sequence in Genbank, the primers for the specific amplification of the Ptf1a gene with efficient amplification ability are designed. , the base sequence is shown in Table 1.
[0030]
[0031] The Ptf1a gene sequence is:
[0032]ATGGAGACGGTGCTGCTGGAGCACTTCCCCGCGGGGCTGGACTCCTTCTCCTCGCCGCCCTACTTCGACGAGGAGGACTTCTTCCCCGAGCCGCCCCCGCGGGAGGCGCTGGGCGCCGACGGGCTGCCGGAGCCCGACGTGGACTTCCTCGGGCGGCAGCTGCACGAGTACTACCGCGACGGCGGGGACCCCGACGGCGGCTATTGCTGCGAGGCGGCGGCCGCCGCCTTCCCGCCGTCTCCCGCCTCGCCCGGCTTCGCCTACGAGTGCTGCGGGGCGGCGGGCGCGGGGCTGCTGTCGCCGGGGGGGCGGCTCCGGGCGCTGGGCTCGG...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com