Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Reticulitermes chinensis Snyder SeBP gene and application of combination of dsRNA of Reticulitermes chinensis Snyder SeBP gene and metarhizium anisopliae in termite control

A technology that combines proteins and termites, applied in DNA/RNA fragments, applications, genetic engineering and other directions, can solve the problems of reducing the control effect of Metarhizium anisopliae on termites, and the control effect of wild termites is not ideal, and achieves improved control effect and excellent effect. , a strong specific effect

Inactive Publication Date: 2021-07-16
HUAZHONG AGRI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, field experiments have shown that termites living in groups can interfere with and inhibit the infection process of Metarhizium anisopliae through a series of hygienic behaviors and physiological immune mechanisms such as grooming, isolation and burial (see "Journal of Economic Entomology", 2008, 101(3):885-893), which greatly reduced the control effect of Metarhizium anisopliae on termites
It is precisely because termite colonies have evolved a variety of social immune strategies (such as active immunity: healthy individuals obtain sublethal doses of conidia through contact with infected individuals, activate their own immune system to improve immunity), resulting in a single biological agent of Metarhizium anisopliae Ineffective against termites in the wild

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reticulitermes chinensis Snyder SeBP gene and application of combination of dsRNA of Reticulitermes chinensis Snyder SeBP gene and metarhizium anisopliae in termite control
  • Reticulitermes chinensis Snyder SeBP gene and application of combination of dsRNA of Reticulitermes chinensis Snyder SeBP gene and metarhizium anisopliae in termite control
  • Reticulitermes chinensis Snyder SeBP gene and application of combination of dsRNA of Reticulitermes chinensis Snyder SeBP gene and metarhizium anisopliae in termite control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1: Obtaining the SeBP gene sequence of the termite termites

[0031] 1. Design the primers required for PCR amplification

[0032] Searched from the transcriptome database of Termites termites, and then used NCBI Nucleotide-BLAST to perform sequence alignment, and confirmed that a termite SeBP gene fragment was obtained. According to the SeBP gene fragment obtained by searching, the upstream primer CCACTCAGGATGGAACGTGT (SEQ ID No. 2) and the downstream primer GTCAGCGCCTGTATGGATCT (SEQ ID No. 3) were designed online using NCBIPrimer-BLAST. The designed primers were sent to Wuhan Qingke Biotechnology Co., Ltd. for synthesis.

[0033] 2. Prepare the template required for PCR amplification

[0034] Three mature worker ants with the same size and good growth conditions were selected and placed in a 2 mL centrifuge tube, placed in liquid nitrogen to rapidly cool the samples, and total RNA was extracted by the RNAiso Plus (Trizol) method. Then, referring to Prime...

Embodiment 2

[0037] Embodiment 2: Synthesis of the SeBP gene dsRNA of Termites black chest

[0038] 1. Primers required for the synthesis of dsRNA of the SeBP gene of Termites melanogaster

[0039] Based on the sequencing results of the nucleotide sequence SEQ ID No.1 of the SeBP gene of the termite termites, an upstream primer ACAAGCACGGAAATG GAAAG (SEQ ID No.4) and a downstream primer GGCTGCTTCCAGAGATGAAC (SEQ ID NO. No.5), the designed primers were sent to Wuhan Qingke Biotechnology Co., Ltd. for synthesis.

[0040] 2. Prepare the template required for SeBP gene dsRNA synthesis

[0041] The primers required for the dsRNA synthesis that all contain the T7 promoter are combined with the plasmid containing the SeBP gene for PCR amplification to obtain a DNA fragment that is 507bp in length, and its nucleotide sequence is as shown in SEQ ID No.6 (both ends Both contain the T7 promoter). The PCR product was purified by the method of phenol / chloroform / isoamyl alcohol (volume ratio 25:24:1)...

Embodiment 3

[0044] Embodiment 3: Detection of the interference effect of the SeBP gene dsRNA of Termites melanogaster

[0045] 1. Injecting termite SeBP gene dsRNA

[0046] Pick 30 mature worker ants with the same size and good growth condition for dsRNA injection. After the termites were anesthetized by freezing on ice, a volume of 100 nL and a total of 2 μg of dsRNA were injected into the intersegmental membrane between the second and third thoracic segments on the side of the thorax of the worker termites using a microinjector. Injected termites were reared in a 9cm-diameter petri dish, and the bottom of the petri dish was covered with wet filter paper as food. Fifteen termites injected with SeBP gene dsRNA (dsSeBP) were used as the treatment group, and 15 termites injected with the same amount of dsGFP were used as the control group.

[0047] 2. Detect termite SeBP gene fragment mRNA expression

[0048] Three days after dsRNA injection, three termites in good condition were selecte...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reticulitermes chinensis Snyder SeBP gene and application of combination of dsRNA of the Reticulitermes chinensis Snyder SeBP gene and metarhizium anisopliae in termite control. The nucleotide sequence of the reticulitermes chinensis Snyder SeBP gene is as shown in SEQ ID No.1, and the dsRNA of the reticulitermes chinensis Snyder SeBP gene is designed based on the same. The dsRNA is injected into bodies of the termites; sterile termites injected with the dsRNA actively contact uninjected termites directly infected with metarhizium anisopliae, and then the uninjected termites obtaining a small amount of metarhizium anisopliae spores become infected companion termites; and after a specified observation time, the antibacterial activity and the survival rate of the infected companion termites are obviously reduced, which indicates that the active immunity of the infected companion termites is broken, and the injection of dsSeBP obviously improves the control effect of the metarhizium anisopliae on the termites. The obtained SeBP gene can be used as a molecular target for termite control, and is combined with metarhizium anisopliae for use, which effectively improves the termite control effect, and has a good application prospect.

Description

technical field [0001] The invention relates to the field of biological technology, in particular to the application of a SeBP gene and dsRNA in combination with Metarhizium anisopliae in termite control. Background technique [0002] Selenium (Se) is an essential trace element that acts as an antioxidant in vivo (Apostolidis et al 2002; Zwolak et al 2012), and Se deficiency can affect the host immune system (Arthur et al 2003). The larval survival of Trichoplusia ni and Helio thisvirescens infected with baculovirus was significantly increased when dietary selenium was added (Popham et al 2005; Shelby et al 2007). Selenium Binding Protein (SeBP) is a protein that binds selenium and plays an important role in the host's immune response mechanism (Song et al 2006; Elhodaky et al 2018). The expression of SeBP gene in honeybees was significantly increased after selenate and selenite induced oxidative stress in honeybees (Alburaki et al 2 019). The expression of SeBP gene in he...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/113C12N15/89A01N63/30A01P7/04
CPCA01N63/30C07K14/43563C12N15/113C12N15/89C12N2310/14
Inventor 黄求应周玮赵星颖高勇勇刘龙
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com